ID: 917526896

View in Genome Browser
Species Human (GRCh38)
Location 1:175796200-175796222
Sequence AAGGGCATATTCAAATCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917526889_917526896 26 Left 917526889 1:175796151-175796173 CCTCTTGGTTCAGAAACAGTAGC No data
Right 917526896 1:175796200-175796222 AAGGGCATATTCAAATCTTGAGG No data
917526888_917526896 27 Left 917526888 1:175796150-175796172 CCCTCTTGGTTCAGAAACAGTAG No data
Right 917526896 1:175796200-175796222 AAGGGCATATTCAAATCTTGAGG No data
917526893_917526896 0 Left 917526893 1:175796177-175796199 CCATGGGAAGGATTCATAGAAAG No data
Right 917526896 1:175796200-175796222 AAGGGCATATTCAAATCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917526896 Original CRISPR AAGGGCATATTCAAATCTTG AGG Intergenic
No off target data available for this crispr