ID: 917528227

View in Genome Browser
Species Human (GRCh38)
Location 1:175808634-175808656
Sequence AACCTTTTGCTGTAATAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917528227_917528230 14 Left 917528227 1:175808634-175808656 CCAGTTTATTACAGCAAAAGGTT No data
Right 917528230 1:175808671-175808693 AGTAAAAGGAAAACGTTCACGGG No data
917528227_917528228 0 Left 917528227 1:175808634-175808656 CCAGTTTATTACAGCAAAAGGTT No data
Right 917528228 1:175808657-175808679 ACAGATTAAAAATCAGTAAAAGG No data
917528227_917528229 13 Left 917528227 1:175808634-175808656 CCAGTTTATTACAGCAAAAGGTT No data
Right 917528229 1:175808670-175808692 CAGTAAAAGGAAAACGTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917528227 Original CRISPR AACCTTTTGCTGTAATAAAC TGG (reversed) Intergenic
No off target data available for this crispr