ID: 917535673

View in Genome Browser
Species Human (GRCh38)
Location 1:175872803-175872825
Sequence GCCCGCTACCACCAGATCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917535673_917535674 -9 Left 917535673 1:175872803-175872825 CCTGTGATCTGGTGGTAGCGGGC No data
Right 917535674 1:175872817-175872839 GTAGCGGGCCACCACCATTCTGG No data
917535673_917535676 -7 Left 917535673 1:175872803-175872825 CCTGTGATCTGGTGGTAGCGGGC No data
Right 917535676 1:175872819-175872841 AGCGGGCCACCACCATTCTGGGG No data
917535673_917535677 -6 Left 917535673 1:175872803-175872825 CCTGTGATCTGGTGGTAGCGGGC No data
Right 917535677 1:175872820-175872842 GCGGGCCACCACCATTCTGGGGG No data
917535673_917535675 -8 Left 917535673 1:175872803-175872825 CCTGTGATCTGGTGGTAGCGGGC No data
Right 917535675 1:175872818-175872840 TAGCGGGCCACCACCATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917535673 Original CRISPR GCCCGCTACCACCAGATCAC AGG (reversed) Intergenic
No off target data available for this crispr