ID: 917535881

View in Genome Browser
Species Human (GRCh38)
Location 1:175874221-175874243
Sequence GATCTGCTCTGATGTGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917535881_917535890 15 Left 917535881 1:175874221-175874243 CCTGATGCACATCAGAGCAGATC No data
Right 917535890 1:175874259-175874281 CAGGTGGATTCCAGGAATGAGGG No data
917535881_917535887 7 Left 917535881 1:175874221-175874243 CCTGATGCACATCAGAGCAGATC No data
Right 917535887 1:175874251-175874273 AAGGATTCCAGGTGGATTCCAGG No data
917535881_917535893 30 Left 917535881 1:175874221-175874243 CCTGATGCACATCAGAGCAGATC No data
Right 917535893 1:175874274-175874296 AATGAGGGCAAGAGTCTAGGCGG No data
917535881_917535889 14 Left 917535881 1:175874221-175874243 CCTGATGCACATCAGAGCAGATC No data
Right 917535889 1:175874258-175874280 CCAGGTGGATTCCAGGAATGAGG No data
917535881_917535892 27 Left 917535881 1:175874221-175874243 CCTGATGCACATCAGAGCAGATC No data
Right 917535892 1:175874271-175874293 AGGAATGAGGGCAAGAGTCTAGG No data
917535881_917535884 -1 Left 917535881 1:175874221-175874243 CCTGATGCACATCAGAGCAGATC No data
Right 917535884 1:175874243-175874265 CACCTGCCAAGGATTCCAGGTGG No data
917535881_917535883 -4 Left 917535881 1:175874221-175874243 CCTGATGCACATCAGAGCAGATC No data
Right 917535883 1:175874240-175874262 GATCACCTGCCAAGGATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917535881 Original CRISPR GATCTGCTCTGATGTGCATC AGG (reversed) Intergenic
No off target data available for this crispr