ID: 917536020

View in Genome Browser
Species Human (GRCh38)
Location 1:175875258-175875280
Sequence CCTTTCCTCTCCTGTTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917536018_917536020 17 Left 917536018 1:175875218-175875240 CCAGGGGAACAGGGTCTCAGACA No data
Right 917536020 1:175875258-175875280 CCTTTCCTCTCCTGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917536020 Original CRISPR CCTTTCCTCTCCTGTTTCCA TGG Intergenic