ID: 917539578

View in Genome Browser
Species Human (GRCh38)
Location 1:175899763-175899785
Sequence AAGTGTGAGCAGAGACTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917539577_917539578 1 Left 917539577 1:175899739-175899761 CCAGGAGGTCTCTCTAAGAAGGT No data
Right 917539578 1:175899763-175899785 AAGTGTGAGCAGAGACTTGAAGG No data
917539574_917539578 3 Left 917539574 1:175899737-175899759 CCCCAGGAGGTCTCTCTAAGAAG No data
Right 917539578 1:175899763-175899785 AAGTGTGAGCAGAGACTTGAAGG No data
917539575_917539578 2 Left 917539575 1:175899738-175899760 CCCAGGAGGTCTCTCTAAGAAGG No data
Right 917539578 1:175899763-175899785 AAGTGTGAGCAGAGACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917539578 Original CRISPR AAGTGTGAGCAGAGACTTGA AGG Intergenic
No off target data available for this crispr