ID: 917542867

View in Genome Browser
Species Human (GRCh38)
Location 1:175932522-175932544
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917542867_917542870 2 Left 917542867 1:175932522-175932544 CCTGCATCATATATAGAACCCTA No data
Right 917542870 1:175932547-175932569 TCATCTACGATACCACCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917542867 Original CRISPR TAGGGTTCTATATATGATGC AGG (reversed) Intergenic
No off target data available for this crispr