ID: 917558733

View in Genome Browser
Species Human (GRCh38)
Location 1:176121597-176121619
Sequence CTACTTTGACAGTTGCAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917558732_917558733 -9 Left 917558732 1:176121583-176121605 CCACAGCTGGAATACTACTTTGA 0: 1
1: 0
2: 0
3: 12
4: 139
Right 917558733 1:176121597-176121619 CTACTTTGACAGTTGCAACTTGG 0: 1
1: 0
2: 0
3: 4
4: 94
917558730_917558733 17 Left 917558730 1:176121557-176121579 CCAGGCTGGAGTGCAGTGACACA 0: 1148
1: 30404
2: 94797
3: 185119
4: 212049
Right 917558733 1:176121597-176121619 CTACTTTGACAGTTGCAACTTGG 0: 1
1: 0
2: 0
3: 4
4: 94
917558729_917558733 18 Left 917558729 1:176121556-176121578 CCCAGGCTGGAGTGCAGTGACAC 0: 2171
1: 59391
2: 158899
3: 216452
4: 181298
Right 917558733 1:176121597-176121619 CTACTTTGACAGTTGCAACTTGG 0: 1
1: 0
2: 0
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917558733 Original CRISPR CTACTTTGACAGTTGCAACT TGG Intronic
907360126 1:53907462-53907484 CTACTGTGACCCTTGCACCTTGG - Intronic
917558733 1:176121597-176121619 CTACTTTGACAGTTGCAACTTGG + Intronic
921401840 1:214732753-214732775 CAAGTTTGACTTTTGCAACTTGG + Intergenic
1065669377 10:28097964-28097986 AAACTTGGACAGTTGCAATTTGG + Intronic
1066545140 10:36491367-36491389 CAACTTTGACAGATGCAATGAGG + Intergenic
1067682142 10:48448052-48448074 GCACTTTGACAGGTGCACCTGGG - Intronic
1074130819 10:110572782-110572804 CTCCTTTCACATTTACAACTTGG + Intronic
1074998563 10:118778599-118778621 CAGCTTTGACACCTGCAACTGGG + Intergenic
1075347044 10:121690447-121690469 CTGCTTTTACAGCTCCAACTTGG + Intergenic
1077550429 11:3197720-3197742 GGACTTTGAGGGTTGCAACTGGG - Intergenic
1079427106 11:20354039-20354061 CAATCTTGACAGTTGCAGCTAGG - Intergenic
1080078365 11:28180987-28181009 CAACTCTGACAGTAGCCACTGGG + Intronic
1084145067 11:67260886-67260908 CTAGTGTGACAGTGGCCACTCGG + Intergenic
1092620751 12:10264432-10264454 CTACTTTGATAATTACACCTTGG - Intergenic
1092991328 12:13903861-13903883 ATACTTTGAGATTTGCTACTAGG + Intronic
1095157101 12:38870865-38870887 CCACTTTGTCATTTACAACTGGG + Intronic
1098604016 12:72367947-72367969 CTAATTTGACATTTGTAATTTGG - Intronic
1103752651 12:123176046-123176068 CTCATTTGACAATTACAACTTGG + Intronic
1110409415 13:75187336-75187358 CTACTTTCTCTGTTGCAACCTGG + Intergenic
1110587543 13:77212044-77212066 CTACTTGGATAGGTGCAAGTGGG - Exonic
1110861065 13:80344993-80345015 CTAATTTTACTATTGCAACTGGG - Intergenic
1111805942 13:93040659-93040681 GTACTTTAACAGCTGGAACTGGG + Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1115643185 14:35348577-35348599 CTATTTTGACAGTTGCCTGTGGG - Intergenic
1115786671 14:36834461-36834483 CTACTTTGCCATTTGCAATGAGG + Intronic
1116283122 14:42934977-42934999 CAATTTTGATTGTTGCAACTGGG + Intergenic
1124446790 15:29741724-29741746 CTACTTTGGCAGTCTTAACTGGG - Intronic
1126524242 15:49632813-49632835 CCAATGTGACAATTGCAACTGGG - Intronic
1127223587 15:56906688-56906710 CTAATTTGGCAGTTGTAACATGG + Intronic
1130284753 15:82545723-82545745 CGACTTTGATATTTGCATCTGGG - Intronic
1133784060 16:8961968-8961990 CCACTTTGTCATTTGCAACCTGG + Intronic
1135088961 16:19497252-19497274 TTACTTTTTCAGTTGCAAATTGG + Intronic
1137879252 16:52029789-52029811 ATACTTTGACAATTGTCACTTGG - Intronic
1143162837 17:4882484-4882506 CTACCTCGACAGCTGCAACAGGG - Intronic
1144115281 17:12083374-12083396 CTACTGTGACAGTTCCAGTTGGG + Intronic
1150638022 17:66930026-66930048 CTACTTTGACAGTTGCTGTGAGG - Intergenic
1152603273 17:81276197-81276219 CCACTGTGACAGGTGCCACTCGG - Intronic
1152978533 18:249246-249268 CTACTTTCAGAGTTGTTACTAGG - Intronic
1155579674 18:27288791-27288813 CTGCTATGGCAGTTCCAACTTGG + Intergenic
927749539 2:25655148-25655170 CTGCTTTCACAGTCGAAACTTGG - Intronic
930142770 2:47969660-47969682 ATCCTTTGACTGTTTCAACTGGG + Intergenic
930322823 2:49877581-49877603 GTACGTTGACAGTTGCAAAACGG + Intergenic
931703054 2:64924450-64924472 CTACTTTAACAGTGGCCACAGGG - Intergenic
933303369 2:80567738-80567760 CTACTGTAACAGTTGGAATTCGG - Intronic
934132399 2:88961307-88961329 CGAATTTGACATTTGCAACAGGG - Intergenic
934136853 2:89004213-89004235 CGAATTTGACATTTGCAACAGGG - Intergenic
934672218 2:96221960-96221982 GTACTTTAACAATTGGAACTGGG - Intergenic
935388608 2:102526479-102526501 CTTCTTTTATAGTTGAAACTCGG + Intronic
939861708 2:147428769-147428791 CAACTGAGACTGTTGCAACTTGG + Intergenic
944877258 2:203974997-203975019 AGACTTTGACAGATGGAACTAGG + Intergenic
945633279 2:212311946-212311968 CGATTTTGACAGTTGCCCCTGGG - Intronic
945653561 2:212595596-212595618 CTACTTTGAAATTCCCAACTGGG + Intergenic
1170617502 20:17966113-17966135 CTTCCTTGACAGTAACAACTTGG - Intronic
1175963622 20:62649251-62649273 CTCCTGTGACAGCTGCAGCTGGG - Intronic
1179182892 21:39060921-39060943 CTGCTGTGACAGCCGCAACTTGG + Intergenic
1179472694 21:41622099-41622121 TTACTTAGCCAGTTGCAACAAGG + Intergenic
1181526592 22:23492915-23492937 CTACTTAGACACTTGCTCCTGGG - Intergenic
952374286 3:32752673-32752695 CAACTTTAACAGTTGAAAGTTGG + Intronic
957842529 3:85690130-85690152 CTAATTTATCAGTTCCAACTCGG - Intronic
958968157 3:100581772-100581794 ATGCTTTGACAGTTGCAAAGTGG - Intergenic
958971474 3:100615479-100615501 CTTCTTTGCCATTTGCATCTTGG - Intronic
965266633 3:166552106-166552128 CTAGTATGACTGCTGCAACTGGG + Intergenic
965428807 3:168561402-168561424 CTGCGTTGACAGTTCCAACTAGG + Intergenic
982739166 4:159039830-159039852 CCACTTTACCAGTTACAACTTGG + Intergenic
983107060 4:163700204-163700226 ATACTATGACAGTAGCAAATTGG + Intronic
984400778 4:179261432-179261454 CTACTTTAACAGTAGACACTTGG - Intergenic
985514711 5:335579-335601 CAACTGTGACAGGTGCCACTGGG + Intronic
995187819 5:109290198-109290220 CTACTAGGCCAGTAGCAACTTGG + Intergenic
998750034 5:145310477-145310499 CCATTTTGACAGTTTCAAGTAGG - Intergenic
1006953771 6:37848175-37848197 TGGCTTTGACAGTTGCAACCTGG + Intronic
1011265847 6:85518145-85518167 ATACTTTTACAGTTTTAACTTGG - Intronic
1011313810 6:86009412-86009434 TTACTATGACAGTTGCAAAGTGG - Intergenic
1011736507 6:90315779-90315801 CTGCTTTGATAGTTGAGACTCGG - Intergenic
1012572597 6:100748237-100748259 CTACATTGACTGTTCAAACTAGG - Intronic
1018963564 6:168466129-168466151 CTACTCTGAGAGCTGGAACTGGG + Intronic
1018963574 6:168466217-168466239 CTGCTTTGAAAGCTGAAACTGGG + Intronic
1024928867 7:54648255-54648277 AAACATTGACAATTGCAACTAGG + Intergenic
1024962504 7:54992364-54992386 CTACTATGACTGTTGGACCTAGG + Intergenic
1027735813 7:81931703-81931725 CCACTTTGACATCTGAAACTGGG - Intergenic
1027752300 7:82164952-82164974 CTCTTTTGACAGCTGCAATTCGG + Intronic
1031865682 7:127036619-127036641 CTACTTTGAAAGTTGCCATTTGG + Intronic
1031930968 7:127685629-127685651 CTCTTTTCACAGTTGCAAGTGGG + Intronic
1037857503 8:22382423-22382445 CTACTTGGACAGATGAGACTGGG + Intronic
1043669455 8:82863731-82863753 CTACTTTTAGAGTTGAAACAAGG + Intergenic
1045769643 8:105720902-105720924 CTACTTTTACAGATGCAGCAAGG - Intronic
1046748420 8:117900617-117900639 TTACTTTGGTAGCTGCAACTTGG - Intronic
1048110872 8:131466853-131466875 CTTCGTTGACAGATGAAACTTGG - Intergenic
1048660744 8:136598385-136598407 CTACTTTCACACTTACAAATGGG + Intergenic
1052243283 9:26301779-26301801 CCATTTTCACAGTTGCAACATGG - Intergenic
1056411544 9:86332954-86332976 TGTCTTTGACAGTTGCATCTGGG + Intronic
1057645360 9:96868975-96868997 CTACTTTGACCTTTGCGCCTTGG + Intronic
1059370627 9:113830085-113830107 CAATTATGACATTTGCAACTAGG - Intergenic
1188252964 X:27922126-27922148 CTACTTTGTCACTTTAAACTCGG - Intergenic
1189515259 X:41707139-41707161 CTACTTTCCCAGTTGAATCTGGG + Intronic
1193274448 X:79569904-79569926 CTCCTTCTACAGGTGCAACTTGG - Intergenic
1197903791 X:131401492-131401514 CTACTGTGAAAGTTTCAACCTGG + Intergenic
1198901171 X:141511629-141511651 CTACTTTGATGGTTGCATCTTGG + Intergenic
1199274434 X:145924847-145924869 CTTCTTTGACAGGTCCAACTTGG - Intergenic
1202051211 Y:20782631-20782653 CCATTTTGGCAGTTGCAACCGGG - Intergenic