ID: 917560361

View in Genome Browser
Species Human (GRCh38)
Location 1:176146233-176146255
Sequence CAGATTAAACAAAAGGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917560361 Original CRISPR CAGATTAAACAAAAGGGTGT TGG (reversed) Intronic
901783560 1:11610065-11610087 CAGGTTAAACACATGGATGTTGG - Intergenic
902490320 1:16776453-16776475 CAGATTCACCCAAAGGATGTGGG - Intronic
902645565 1:17795668-17795690 GAAATTAAACAGAAGGGTGGGGG + Intronic
905662150 1:39735892-39735914 CTGATTAAACCACTGGGTGTTGG + Intronic
906910921 1:49949410-49949432 CAGAGTAAACAGAATGCTGTGGG + Intronic
908623801 1:66016984-66017006 CAGAGAAAACAACAGAGTGTGGG + Intronic
909616598 1:77617103-77617125 CAGATGAAACTAAAGCGTGGGGG - Intronic
912099014 1:106183332-106183354 CTGATAGAACAAAAGGGTATAGG - Intergenic
914877486 1:151522961-151522983 CAGCTTAATCAAATGGCTGTTGG + Intronic
917090139 1:171344673-171344695 CAGATTACACAACAGGGAATGGG - Intergenic
917560361 1:176146233-176146255 CAGATTAAACAAAAGGGTGTTGG - Intronic
918431143 1:184462026-184462048 CAAATTAAACAACAGGGAGGAGG + Intronic
919310575 1:195901667-195901689 CAGATTTAACTCAAGTGTGTTGG - Intergenic
919325045 1:196097039-196097061 CAGAAAAAACAAAGGTGTGTGGG - Intergenic
919641182 1:200045810-200045832 CAGACTAAAAAAAAGGGGGTGGG - Intronic
920022386 1:202966224-202966246 CAGATGAGCCAAAAGGGTCTGGG + Intronic
921877225 1:220211671-220211693 CAGATTTAACAAAAGTCAGTGGG - Intronic
924724594 1:246657436-246657458 CTGCTGAAACAAAAGGGTTTTGG + Intronic
1066404512 10:35105998-35106020 GAGATTAAACAAAAATGTGTAGG + Intergenic
1067099115 10:43321978-43322000 TGGCTTAAACAACAGGGTGTTGG + Intergenic
1068450718 10:57183623-57183645 CAGATTAAAGAAAATGGGGTGGG + Intergenic
1070430938 10:76336940-76336962 CAGATTAAAAAAAGGGGGGTGGG - Intronic
1071383898 10:85100585-85100607 TAGATGAAACAAAAGGGAATAGG - Intergenic
1071889455 10:89987131-89987153 CATATTAAATATAAGTGTGTTGG + Intergenic
1073593289 10:104776705-104776727 AAGACTAAAGAAAAGGCTGTGGG - Intronic
1076026437 10:127118620-127118642 CAGAGCAAGTAAAAGGGTGTTGG - Intronic
1077781347 11:5333159-5333181 TAGATACAACAAAAGGGTGATGG - Intronic
1077806294 11:5594603-5594625 CAGTTAAAAAAAAAGGATGTTGG - Intronic
1079389656 11:20010502-20010524 CAAATTAAAAAAAAGGTGGTGGG - Intronic
1079633284 11:22704747-22704769 CAGAATAAACAAAATGCAGTGGG + Intronic
1080577036 11:33609412-33609434 CAGAGGAACCAAAAGGGTATAGG + Intronic
1080716358 11:34805564-34805586 CATTTTACAGAAAAGGGTGTCGG + Intergenic
1081543951 11:44056492-44056514 CAGATAACACAGCAGGGTGTAGG + Intronic
1081562854 11:44235042-44235064 CAGATTAAACCAAAGTGTATAGG + Intronic
1082121075 11:48380119-48380141 CAGAAAAAACAAAAAGGGGTGGG - Intergenic
1083205636 11:61147155-61147177 CAGATCACAGAAAAGGGGGTGGG + Intronic
1084764083 11:71296293-71296315 CACATTAAAAAAAACGATGTAGG + Intergenic
1086467268 11:87067918-87067940 CAGATTAAAAAAAGGGGGGGCGG - Intronic
1087779094 11:102284467-102284489 CAAATTAATCAGAAGGATGTAGG - Intergenic
1090878644 11:130814013-130814035 CAGATAAAACAAAAAGGTGGAGG + Intergenic
1093160313 12:15739495-15739517 CAGATGGAACAAAAAGGTGGAGG + Intronic
1093659817 12:21742902-21742924 CAGATTAAAAAAAAAGCTGAAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1098150484 12:67541385-67541407 CAGAATAAGCAGAAGGGTATTGG + Intergenic
1099355205 12:81626206-81626228 TAGGTTAAAAAAAAGGGGGTGGG + Intronic
1099578816 12:84415302-84415324 CAGATTTAACAAAAAGGAGCTGG + Intergenic
1100122240 12:91382300-91382322 CAGGTAGAACAAAAGGGAGTGGG + Intergenic
1100713283 12:97280022-97280044 GAGATTAAACAAGAGAGTGTTGG - Intergenic
1101234229 12:102772144-102772166 CAGATTAAACTAAATGGGGATGG + Intergenic
1102188466 12:110967625-110967647 AAGATTAAATAAAAGGATGATGG + Intergenic
1103424694 12:120823006-120823028 CAAATTAAACAGACAGGTGTAGG + Intronic
1104272136 12:127292173-127292195 CAAATAGAACAAAAGGGTGGAGG + Intergenic
1105531828 13:21227775-21227797 CAAAATAAACAATGGGGTGTTGG - Intergenic
1106875151 13:34063851-34063873 CAGATAAAACAAAAAGGTGAAGG - Intergenic
1111513075 13:89291739-89291761 CAGATTGAAAATAAGGGTATGGG - Intergenic
1112100351 13:96181979-96182001 CAGATAAAACAAAACAGGGTAGG - Intronic
1112631865 13:101170339-101170361 CAGATAGAACAAAAAGGTGGAGG - Intronic
1114962064 14:27904233-27904255 CAGAATAAACACAAATGTGTTGG - Intergenic
1116352178 14:43876562-43876584 TAGATTAAAGAAAAAAGTGTGGG + Intergenic
1116505119 14:45668310-45668332 CAGATTAAAGACAAGGTTCTAGG + Intergenic
1116688382 14:48072741-48072763 CAGAGGAAACAAGACGGTGTGGG + Intergenic
1117475273 14:56088064-56088086 CACATTAAACACAAGTTTGTGGG + Intergenic
1118460341 14:65981339-65981361 CAGGGCAGACAAAAGGGTGTTGG + Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1120154862 14:81082438-81082460 CACATTTCACAAAAGGGGGTGGG - Intronic
1125923741 15:43544148-43544170 CAGATTTAACAATAGGGAATGGG - Intronic
1125930000 15:43593729-43593751 CAGCTTAAACCGAGGGGTGTGGG + Intronic
1125943168 15:43693561-43693583 CAGCTTAAACCGAGGGGTGTGGG + Exonic
1126177450 15:45750221-45750243 AAGATTCAACAATAGGATGTTGG - Intergenic
1126349820 15:47733177-47733199 AAGATTAAAAAAAAGTGAGTGGG - Intronic
1126695113 15:51319172-51319194 CTGATTAAGGGAAAGGGTGTAGG - Intronic
1127438760 15:58985493-58985515 CAGATGAAATAAAAGGGTGAGGG - Intronic
1128066107 15:64765578-64765600 CAGAATAAAAAAAAGGGCGGGGG + Intronic
1130029253 15:80296684-80296706 CAGATGAAACAAAAAGGCGGAGG - Intergenic
1131780411 15:95850545-95850567 CAGATAAAACAAAAGCGTGGAGG + Intergenic
1135458685 16:22622057-22622079 CAGAGTAAATAAAAGCGTGAGGG - Intergenic
1137404659 16:48179912-48179934 TGGCTGAAACAAAAGGGTGTAGG + Intronic
1137706592 16:50539794-50539816 CAGAAGAAACAAAATGATGTGGG + Intergenic
1141369585 16:83474580-83474602 CAGAAAAAACAAGAGGGTGGGGG + Intronic
1142720722 17:1774004-1774026 CACATTAAACTAAAGGGGCTTGG + Intronic
1143418284 17:6766673-6766695 CAGGTAAAACAAAAAGTTGTAGG - Intronic
1144542172 17:16155004-16155026 CAGAAGAAAGAAAAGGGTGATGG - Intronic
1149341850 17:55695004-55695026 GAGATTAAACAAAATGGCTTGGG - Intergenic
1150519501 17:65851723-65851745 GAGATTAAATATAAGGGTGGTGG + Intronic
1153116159 18:1659068-1659090 GAGATTCATCAAAATGGTGTTGG + Intergenic
1155049931 18:22138087-22138109 CAAATTAAAAAAAAGGGGGGGGG - Intergenic
1156049755 18:32918266-32918288 CAAACTTAAAAAAAGGGTGTGGG + Intergenic
1156164549 18:34402675-34402697 CAGACTTCACAAAAGGGTGATGG + Intergenic
1157017943 18:43741808-43741830 CAGAATAAAAAAAAGGATCTTGG + Intergenic
1158671196 18:59475509-59475531 CAGAATAAACAAAAGTATGGAGG - Intronic
1158692339 18:59671783-59671805 CAGATTAGATAAAAGGATGGTGG + Intronic
1159848511 18:73496138-73496160 CAGATTAAAAAAAGGGGGGGCGG + Intergenic
1160396092 18:78573156-78573178 CACATGAAAGCAAAGGGTGTGGG + Intergenic
1162544817 19:11322515-11322537 CACATTAAACCAAAGGCCGTGGG - Exonic
1163529412 19:17841125-17841147 GAGATTAAACAAGAGGCTGTAGG + Intronic
1164929036 19:32159748-32159770 CAAATAAAACAAAAAGTTGTAGG - Intergenic
1165708902 19:37995673-37995695 CAGAATGAACAAAAGCGGGTTGG + Intronic
1165977659 19:39691498-39691520 CAGAGAAAAGAAAAGGGTGTGGG + Intergenic
1166663500 19:44662754-44662776 CAGACCACACAGAAGGGTGTGGG + Exonic
1168577641 19:57526682-57526704 CAGAATAAACACAAACGTGTGGG + Intergenic
926677127 2:15635022-15635044 CAGATTAAAAAAAAAAATGTTGG + Intergenic
927069223 2:19508526-19508548 TAAATTATACACAAGGGTGTGGG - Intergenic
927279154 2:21288478-21288500 CAGAGTGAACAAAGGGCTGTAGG + Intergenic
930976257 2:57465149-57465171 TAAATTAAACAAAAAGGAGTAGG - Intergenic
931067836 2:58606828-58606850 CAGAGAGAACAAAAGGATGTGGG + Intergenic
931195969 2:60052632-60052654 CAGATAGAACAATAGGGTGCAGG - Intergenic
932609246 2:73186673-73186695 CAGATTCAAGAAAAGGGGTTGGG + Intergenic
933463729 2:82623473-82623495 CAGATGAAAAGAAAGGGTATGGG - Intergenic
937188014 2:120064436-120064458 CATATTTAACAATAGGGTCTGGG + Intronic
937327237 2:120997720-120997742 CAAACTATACAAAAGGATGTAGG + Intergenic
938052996 2:128192072-128192094 CAGATTAAACATAAGAGGCTTGG - Exonic
941389864 2:164898145-164898167 CATATTAAATAAAAGGGGGATGG + Intronic
941434651 2:165454213-165454235 CAGAGTAAACAAATTGGTCTTGG - Intergenic
944529971 2:200657911-200657933 AAAATTAAACAAAAGCATGTTGG - Intronic
944956493 2:204817454-204817476 CAGAGTACACAGAAGGGTATTGG - Intronic
946605336 2:221398515-221398537 CAGATTAAACACCATCGTGTTGG - Intergenic
1171569055 20:26228952-26228974 CTGAGTAAATAAAAGGGTTTGGG + Intergenic
1172407728 20:34702066-34702088 CAGCTTGAGCAAAAGGGTGGAGG + Intronic
1172956387 20:38762508-38762530 CACATTACAGAAAAGTGTGTGGG + Intronic
1177500626 21:21950062-21950084 CAGACAAAACAAAAAGGTGGAGG - Intergenic
1179067310 21:38037645-38037667 TAGGTTAAACAAAAGCGAGTAGG + Intronic
1183049675 22:35250680-35250702 CAGCTTACACAAAGGGGAGTGGG + Intergenic
1183606831 22:38871270-38871292 CAGCTTCAACAAGAGGGTTTTGG - Intronic
949906233 3:8860973-8860995 CAAATACAACAAAAGGGTGGAGG + Intronic
950953009 3:17021233-17021255 CAGATTAAACAACAGCCTTTGGG - Intronic
951601573 3:24381811-24381833 CAGAGAAAACAAAAAGGTCTCGG + Intronic
952167776 3:30769687-30769709 CAGTTTAGACATATGGGTGTGGG - Intronic
952535363 3:34303724-34303746 CCGCTGAAACAAAAGGGTGGAGG + Intergenic
955066362 3:55536689-55536711 TACACTAAACAAACGGGTGTGGG + Intronic
955414815 3:58682247-58682269 CAGATTAAACATTAAGGTATGGG - Intergenic
956466439 3:69524854-69524876 CAGACAAAACTAAAAGGTGTGGG + Intronic
957946608 3:87071130-87071152 AAGCTAAAACAAAAGGGTCTTGG + Intergenic
958710552 3:97711674-97711696 CAGATAGAACAAAAGAGTGGAGG - Intronic
959245981 3:103868598-103868620 CAGATAGAACAAAAAGGTGGAGG + Intergenic
962277664 3:134028616-134028638 CAGATTACACAAAGGGATGATGG - Intronic
963291798 3:143497805-143497827 GATTATAAACAAAAGGGTGTGGG + Intronic
963367562 3:144356943-144356965 CAGATTAAAAAAAATCTTGTTGG + Intergenic
964422798 3:156521791-156521813 CAAAGGAAACAAAAGTGTGTTGG - Intronic
965423231 3:168488481-168488503 CATATTAGAGAAAAGAGTGTGGG + Intergenic
966706254 3:182918278-182918300 CAGATTCAAATTAAGGGTGTTGG - Exonic
967571231 3:191030532-191030554 TAGCTTAAACAATAGGGTTTTGG - Intergenic
968476515 4:812521-812543 CAGAGTAATAAAAAGGGTATGGG + Intronic
969233067 4:5845343-5845365 CAGATTAACCAAAAAGCAGTAGG - Intronic
970551214 4:17182991-17183013 CAGATTAAGCGAAAGGGGGTTGG - Intergenic
970994171 4:22246906-22246928 TTGATTAAACAAATGGGTGATGG - Intergenic
971495820 4:27264147-27264169 TAGATTAAACAGAAGGTTATGGG + Intergenic
972688312 4:41372200-41372222 AAGATTACACAAAAAGGTGGGGG - Intronic
973755210 4:54067355-54067377 CAGAGCCAGCAAAAGGGTGTGGG + Intronic
973986156 4:56355997-56356019 CTGATTACACAAAAAGGTTTAGG + Intronic
975256332 4:72240057-72240079 AAGATTAAACAAAAGGAAGGAGG + Intergenic
975953945 4:79813156-79813178 CAGCTTAAAACAAAAGGTGTTGG + Intergenic
975967744 4:79995059-79995081 TAGATGAAACAACAGGGAGTTGG - Intronic
977191107 4:94001855-94001877 CAGATAAATCAAAATTGTGTAGG - Intergenic
978819016 4:112943968-112943990 CAGACTAAACAAAATGGAGATGG + Intronic
979965662 4:127073914-127073936 CATACTAAACCAAAGGGAGTTGG - Intergenic
980402755 4:132313877-132313899 CAGATAAAATAAAAAGGTGGAGG - Intergenic
981616950 4:146652398-146652420 CAGAGTGTACAAAAGGGTTTGGG - Intergenic
983301846 4:165935703-165935725 CAGACTAAACTATAGTGTGTAGG - Intronic
984911971 4:184682288-184682310 CAGAATAAACAAAAAGGAGTTGG + Exonic
988140548 5:27233521-27233543 CAAAATAAACATAAGGGTGCGGG + Intergenic
989209899 5:38847939-38847961 CAGGTTAAAGAAAAGGGTAGAGG - Intronic
989296004 5:39827426-39827448 TAGAGTAAACAAGAGAGTGTAGG - Intergenic
990097928 5:52141240-52141262 CAGATTAAAAATTAGGTTGTGGG + Intergenic
990455799 5:55986431-55986453 CAGATTAAACAAAAAAGAATGGG - Intronic
991082642 5:62617889-62617911 CAGTTTATACAGAAGGCTGTGGG - Intronic
993132599 5:83918161-83918183 GAGATTTGACCAAAGGGTGTGGG - Intergenic
993632784 5:90307044-90307066 CAGATACAACAAAAGGTTTTAGG - Intergenic
993729407 5:91404770-91404792 CAAAATAAATAAAAGAGTGTTGG + Intergenic
993767947 5:91886005-91886027 GAGATAAAACAAAAGGCAGTTGG + Intergenic
994982610 5:106895318-106895340 CAGATAGAACAAAAAGGTATAGG - Intergenic
995202136 5:109437914-109437936 CAAAATAAATAAAAGGGTATTGG + Intergenic
995849243 5:116527361-116527383 CAAATTAAACAAATGGATTTGGG + Intronic
996610542 5:125373510-125373532 GGGATTAAAAAAAAGGGGGTGGG - Intergenic
999043043 5:148436768-148436790 CAGAGTAAACAATAGAGTCTGGG - Intronic
1000617362 5:163442651-163442673 CAAAATAAACAAAATGGAGTTGG + Intronic
1001214828 5:169845944-169845966 CAAATTAAAGAAAATGATGTTGG + Intronic
1002867245 6:1132309-1132331 AAAATTAAACGTAAGGGTGTGGG + Intergenic
1004843161 6:19610386-19610408 CAGATTTATCAAAAGACTGTGGG - Intergenic
1006748096 6:36359143-36359165 CAGATTAAACAGAAAGGGGATGG + Intronic
1008682656 6:53890390-53890412 CAGATTGAACTAGAGCGTGTGGG + Intronic
1010474487 6:76269530-76269552 CAGATTAAAAAAAAAGATGTTGG + Intergenic
1011061627 6:83276069-83276091 CAGATTAAACTAAAAAATGTTGG - Intronic
1011104046 6:83758918-83758940 CAGATTAACCACCTGGGTGTTGG + Intergenic
1011600831 6:89058653-89058675 GAGGTTAAAGAAAAGAGTGTAGG - Intergenic
1011876072 6:91964122-91964144 CAAAGTAAATAAAAGGTTGTTGG + Intergenic
1012136021 6:95556998-95557020 CAGATTAATAAAAAGGAAGTGGG - Intergenic
1014194356 6:118535597-118535619 GAGAGGAAACAAAATGGTGTGGG - Intronic
1014544635 6:122719417-122719439 AAGATTACACAAAAGGGTGAAGG + Intronic
1014954746 6:127600665-127600687 CAGAAGAAACAAAAGGGAATGGG - Intergenic
1015049931 6:128828041-128828063 CTGATTAATCAAAAAGGTGCAGG - Intergenic
1015345167 6:132147908-132147930 CAGCTCAGGCAAAAGGGTGTAGG - Intergenic
1020835522 7:13145590-13145612 CAGGTTAAAAAAAAAGGTGGGGG - Intergenic
1020844612 7:13267358-13267380 CAGAACTAAAAAAAGGGTGTTGG + Intergenic
1021272152 7:18603122-18603144 CACACTAAACAGAAGGATGTTGG - Intronic
1022270768 7:28805444-28805466 CAGCTGAATCAGAAGGGTGTCGG + Intronic
1023446624 7:40238377-40238399 TAGATTAAAAAAAAGGCTCTCGG + Intronic
1024442324 7:49434983-49435005 CAGCTTACACCAAAGTGTGTGGG + Intergenic
1028637640 7:93007454-93007476 CTGTTTAAACAAAAGAGCGTGGG - Intergenic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1029344195 7:99966767-99966789 CAGATTAGACAATGGGGTGGGGG + Exonic
1032166303 7:129547733-129547755 CAGAGGAAACAAAAAGGTGGAGG - Intergenic
1032649661 7:133863881-133863903 CAGATTTCACAAAAGGCAGTGGG + Intronic
1034071983 7:148194778-148194800 CAGATGGAACAAAAAGGTGAAGG - Intronic
1034306359 7:150047936-150047958 CAGATTAAAAAAAAGGCGGTGGG + Intergenic
1038003106 8:23407137-23407159 CAGATGAAACAAAATGATGGCGG + Intronic
1039671030 8:39598786-39598808 CAAAAAAAAGAAAAGGGTGTTGG + Intronic
1039836889 8:41263724-41263746 CTGATTAAACATAAGGGCTTTGG + Exonic
1041099715 8:54383617-54383639 CAGATTAAATAAGAGTTTGTGGG - Intergenic
1042551218 8:69995544-69995566 CAGATGAAACAAAAGGGAACTGG + Intergenic
1043126097 8:76397640-76397662 CATATTAGACAAAAGAGTTTGGG - Intergenic
1043184932 8:77136419-77136441 CACAATAAACATGAGGGTGTAGG + Intergenic
1043303065 8:78759062-78759084 CAGATTAAAAAAAAAGGTGGGGG - Intronic
1044482949 8:92714117-92714139 ATGATTAAAGAAAAGGGGGTGGG - Intergenic
1046446158 8:114322643-114322665 CAGATTAAAGATAACGGTGAAGG - Intergenic
1047398861 8:124529119-124529141 CACACTTCACAAAAGGGTGTGGG - Intronic
1047520923 8:125594792-125594814 CAGATTAAATAGAAGAGTGCTGG + Intergenic
1048479642 8:134776800-134776822 AAGATTGCACAAATGGGTGTGGG - Intergenic
1049348142 8:142149686-142149708 CAGATTAAACAAGATGGAGCAGG + Intergenic
1050079047 9:1895499-1895521 CAGATGAAAGAAAAGGGAATAGG + Intergenic
1055093237 9:72383964-72383986 AAGATTAAAAAAATGGATGTGGG - Intergenic
1057608398 9:96518615-96518637 AAGATTAAATAAGATGGTGTGGG - Intronic
1058760575 9:108127540-108127562 TAGATTAACCAAAAGGGTGATGG + Intergenic
1058774648 9:108271747-108271769 AAGATTAAATAAAATGGAGTTGG + Intergenic
1058781818 9:108344890-108344912 CTGAATAAACATAATGGTGTGGG - Intergenic
1186087191 X:6003211-6003233 CACACTTAACAAAAGGGGGTGGG + Intronic
1186209495 X:7234477-7234499 CAGAGCAAATAAAAGGGTGGTGG + Intronic
1186716826 X:12260823-12260845 CAGATTAAGCAAACGCGTGGAGG - Intronic
1187654357 X:21453359-21453381 GAGTTTAAACAGAAGGATGTGGG + Intronic
1191625946 X:63271688-63271710 CAGAAAAAAAAAAAGGGTGGGGG - Intergenic
1192327052 X:70141905-70141927 GAGATTAAAAAAAAGGGGGGGGG + Intronic
1192660894 X:73041613-73041635 CAGATAGAACAAAAAGGTGGAGG + Intergenic
1192798261 X:74442456-74442478 AAGATGAGACAAAAGAGTGTGGG + Intronic
1194957038 X:100193023-100193045 CAGGTTCAACAAAAGGGTAACGG - Intergenic
1195642009 X:107185896-107185918 AACATTTAACAAAAGGGAGTAGG + Intronic
1195660441 X:107372644-107372666 CAGATGAAACAAATGGTTGCAGG - Intergenic
1196226405 X:113172566-113172588 CAGATAAAACAAAAAGATGGAGG + Intergenic