ID: 917565463

View in Genome Browser
Species Human (GRCh38)
Location 1:176207689-176207711
Sequence GTCTCTCTCTTCTGAGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917565459_917565463 -2 Left 917565459 1:176207668-176207690 CCGGAACGGGAAGAAGGAGCTGT 0: 1
1: 0
2: 3
3: 14
4: 164
Right 917565463 1:176207689-176207711 GTCTCTCTCTTCTGAGGGGTAGG 0: 1
1: 0
2: 1
3: 27
4: 247
917565457_917565463 5 Left 917565457 1:176207661-176207683 CCACATTCCGGAACGGGAAGAAG 0: 1
1: 0
2: 0
3: 8
4: 63
Right 917565463 1:176207689-176207711 GTCTCTCTCTTCTGAGGGGTAGG 0: 1
1: 0
2: 1
3: 27
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917565463 Original CRISPR GTCTCTCTCTTCTGAGGGGT AGG Intergenic
901795947 1:11679875-11679897 GGAACTCTCTTCTGAGGGGTGGG + Intronic
903128166 1:21261752-21261774 GTCACTCCCTTCGGAGGGGTGGG + Intronic
903864525 1:26388618-26388640 GTCTGTCTGTACTGAGGGCTGGG - Intergenic
907894400 1:58671937-58671959 GCATCTCTCTGCTGAGGAGTTGG - Exonic
910448722 1:87326212-87326234 CAGTCTCTCTTCTGAGAGGTAGG - Intergenic
912285645 1:108365899-108365921 GTCTTTCTGTTATGGGGGGTGGG + Intergenic
912721091 1:112020759-112020781 GTCTCTCCCTTCTGCCGGGTGGG + Intergenic
913119691 1:115728447-115728469 TTTTCCCTCTTCTCAGGGGTAGG + Intronic
913321626 1:117592564-117592586 GTCTGTATCTCTTGAGGGGTAGG - Intergenic
917565463 1:176207689-176207711 GTCTCTCTCTTCTGAGGGGTAGG + Intergenic
917868481 1:179221089-179221111 GGCTTTCACATCTGAGGGGTGGG - Intronic
918066611 1:181105689-181105711 GTCTCGCTGGTCTGAGGGGCTGG + Intergenic
918912455 1:190591542-190591564 CTCTCTCTCTTTTGAGGGAGAGG + Intergenic
921769782 1:219022405-219022427 GTCTCTCCCTTCAGAGAAGTGGG - Intergenic
922813742 1:228434203-228434225 GTGTCTCTCCCCTGAAGGGTAGG + Intergenic
923678916 1:236103262-236103284 GTGTCTCCCTTTTGTGGGGTGGG - Intergenic
924098008 1:240574277-240574299 TTCTTTCTTTTCTGAGGAGTGGG - Intronic
1063209250 10:3863980-3864002 GTCTCAGCCTTCTGAGGAGTGGG - Intergenic
1063279759 10:4614679-4614701 GTATCTCTCCTCTGATGAGTTGG + Intergenic
1064862755 10:19845688-19845710 GCTTCTCTCTGCTGAGGGGTTGG - Intronic
1067282886 10:44886238-44886260 GTCTCTCTGTTGTGTGGCGTAGG - Intergenic
1068446627 10:57133373-57133395 TTCTCTCTCTTCTGGAGTGTGGG + Intergenic
1068723023 10:60268120-60268142 GTCTCTACCTCCTGAGGGGCTGG + Intronic
1070759703 10:79016396-79016418 CCTTCTCTCTTCTCAGGGGTTGG + Intergenic
1071076434 10:81759202-81759224 GTCTCTCACTTTTGAGGGTGGGG - Intergenic
1071551649 10:86570742-86570764 GTCTCTCTTTTTTGGGGGGAGGG + Intergenic
1071576511 10:86730534-86730556 GTCCCTTTCTTCTATGGGGTAGG + Intronic
1071751007 10:88475702-88475724 GTCTCTGGCTTTTGGGGGGTGGG + Intronic
1072417601 10:95262105-95262127 GTCTCTCTCTGGGGAGGGGAGGG + Intronic
1072654569 10:97320901-97320923 GTCTCTCTTCTCAGAGTGGTGGG + Exonic
1073568770 10:104558200-104558222 GTCTCTGTCTGCTGAGAGGCTGG - Intergenic
1074305967 10:112278781-112278803 GTCCCCCTCTTCTGAGGGAAAGG + Intergenic
1074708486 10:116157490-116157512 CTCTATCCCTTCTGAGGGGCTGG - Intronic
1075604868 10:123797359-123797381 TTTTCTCACTTCTGAGTGGTAGG + Intronic
1076724679 10:132407834-132407856 GGCACCATCTTCTGAGGGGTAGG + Intronic
1076730757 10:132437715-132437737 GTCTCTCTCTTCCGAGGGCAAGG + Intergenic
1077031943 11:472331-472353 GTCTCTCAGTGCTGAGGGGTGGG - Intronic
1077844484 11:6010608-6010630 TTCTCACACTTCTGATGGGTAGG - Intergenic
1078528232 11:12116985-12117007 GTTTCTCTCCTCTGAGGGTCAGG + Intronic
1078568320 11:12436152-12436174 ATCTCCCTCTTCTGAGGATTAGG + Intronic
1079190522 11:18273227-18273249 GCCTTTCTGATCTGAGGGGTTGG - Intergenic
1079247784 11:18765758-18765780 GTCTCTCCATTCTGAGGTCTGGG + Intronic
1080001720 11:27358211-27358233 GTCTGTCTCTTCTGAGGGTAAGG + Intronic
1080092034 11:28360014-28360036 CATTCTCTCTCCTGAGGGGTTGG - Intergenic
1081415766 11:42813331-42813353 GTCTCTCTCGTTTGAGGAATTGG - Intergenic
1081679863 11:44994648-44994670 GTCTCTCCCATCGGAGGGGACGG - Intergenic
1083482573 11:62959248-62959270 GTCTCTCTCTGGTGGGGGCTGGG + Intronic
1083695436 11:64439308-64439330 TTCTCTCTCTCCTGGGGGCTGGG + Intergenic
1084031366 11:66482538-66482560 GTCTGTCTCTTTCAAGGGGTAGG + Intronic
1086540597 11:87905629-87905651 GTCTCTCTATTCTGGCTGGTTGG + Intergenic
1087430334 11:98045569-98045591 GTAGCTCTCTCCTGAGGGCTAGG - Intergenic
1089834653 11:121359369-121359391 TTCTTCCTCTTCTGAGGGGTCGG - Intergenic
1090556383 11:127880772-127880794 CTCTCTCTCCCCTGAGAGGTAGG - Intergenic
1090619020 11:128544869-128544891 GTCTCTCTATTCAGAGGTCTGGG + Intronic
1090755643 11:129788007-129788029 GTTAATCTCTTCTGAGGGTTTGG + Intergenic
1092070312 12:5626475-5626497 GCCTCTCCCATCAGAGGGGTGGG + Intronic
1095874295 12:47063722-47063744 GTCCCTCTCTTCAGAGAGGCGGG + Intergenic
1097208126 12:57341424-57341446 GTCTTTTTCTTCTGAGAGGGAGG - Intronic
1098522357 12:71447765-71447787 GTCTCTCCCTTGTAAAGGGTCGG - Intronic
1100667221 12:96768204-96768226 GTCTCACCCTTCTGAGTAGTTGG - Intronic
1101251953 12:102945679-102945701 GACTCTCTCTTCAGAGGAGTGGG + Intronic
1103145707 12:118593950-118593972 ATCTCTCTCTTCTGAGAGCTAGG + Intergenic
1103984390 12:124757773-124757795 TTCTCTCTCTTCTGAGCTGTGGG - Intergenic
1104977875 12:132560297-132560319 GTCCCGCTCTTCTGGGGGGGCGG - Intronic
1105946741 13:25196842-25196864 GTCTCGCACATCTGAGGGCTGGG + Intergenic
1107380929 13:39855838-39855860 GTCTCCCAGTTCTGAGGGCTTGG + Intergenic
1109484004 13:62995781-62995803 TTCACTCTCTTCTATGGGGTTGG + Intergenic
1110348787 13:74481422-74481444 GTCTTTTTTTTCTGAGGGATGGG - Intergenic
1110524181 13:76516422-76516444 CTCACTTTCTTCTTAGGGGTGGG - Intergenic
1111085791 13:83373743-83373765 GTCTCTCCCATCAGAGAGGTGGG + Intergenic
1112902196 13:104370809-104370831 TTCTCTCTTTTATCAGGGGTTGG - Intergenic
1113035356 13:106041792-106041814 CGCACTCTCTTCTGATGGGTAGG + Intergenic
1113632469 13:111897603-111897625 GTTTCTCTTTCCTGAGGGGATGG - Intergenic
1115021780 14:28689913-28689935 GCCTCTCTTTTCTGAGTGGAAGG - Intergenic
1115264657 14:31488469-31488491 CTCTCTCTCTTTTGAGAGGCAGG - Intergenic
1118490483 14:66254435-66254457 TTCTGTCTCTTTTCAGGGGTTGG - Intergenic
1119189498 14:72670816-72670838 TTGTCTCTTTTCTGAGGGGAGGG - Exonic
1119207676 14:72806795-72806817 GTCGGTCTCTTCTAAGTGGTGGG + Intronic
1119478095 14:74942683-74942705 GTCTCTCTCCTCCAAGGGGTGGG + Exonic
1120633935 14:86927964-86927986 GAATCTCTCTTCTGTGGGGAAGG + Intergenic
1122051481 14:99063934-99063956 GCCTCCCTCTTCAGATGGGTGGG - Intergenic
1125275464 15:37984820-37984842 GTCTCACAGTTCTGAAGGGTGGG - Intergenic
1125590886 15:40853937-40853959 GTCTCTCTCTTCTGTGGCCAGGG + Intronic
1126489932 15:49225682-49225704 CTCTCTGTCTTCTGAGGGTGTGG + Intronic
1127627333 15:60793014-60793036 CTCTCTCTCTTTTGAGGGAGTGG - Intronic
1128260506 15:66229663-66229685 GTCTCTCTCTGCTCTGGGGAAGG + Intronic
1128576439 15:68778962-68778984 GTTTGGCTCTTCTGAGGGGCAGG + Exonic
1128718159 15:69925313-69925335 GTCTATGTGTTGTGAGGGGTTGG - Intergenic
1130810617 15:87374272-87374294 GCCTCTCCTTTTTGAGGGGTGGG - Intergenic
1131799069 15:96051245-96051267 ATCTATCTCTTCTCAGGGTTAGG + Intergenic
1132562171 16:600879-600901 GTCTCTGTCTTCTGAAGAGCTGG + Intronic
1132724923 16:1334367-1334389 GTCTCTCCCCTCGGAGGGGGCGG - Intronic
1132729588 16:1354921-1354943 GTCTCCCACGTCTGTGGGGTGGG + Intronic
1132729639 16:1355086-1355108 GTCTCCCGCGTCTGCGGGGTCGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1133409793 16:5558676-5558698 GTCTCAGTCTTGTGTGGGGTGGG + Intergenic
1134052090 16:11144483-11144505 GTCCCTCTCAGCTGAGGGGAGGG - Intronic
1134216585 16:12321278-12321300 GTGTCCCTGTTCTGAGGGGGAGG - Intronic
1134541508 16:15070582-15070604 GTCTTTCTCTTGAGAGGTGTTGG - Intronic
1135234646 16:20743804-20743826 CTCTCTCTCTTCTGCTGGCTGGG + Intronic
1135683377 16:24478087-24478109 ATCTCTCTCTTGTCAAGGGTTGG + Intergenic
1135874864 16:26189177-26189199 GTCTCTTTCTTCCAAGGGGAAGG + Intergenic
1136016019 16:27401806-27401828 TTCTCTCTGTGCTGAGGGGCTGG + Intergenic
1136263295 16:29096782-29096804 GTCTTTCTCTTGAGAGGTGTTGG + Intergenic
1136297712 16:29313116-29313138 GTCCCGCTCTTCAGAGGGGAGGG - Intergenic
1141465130 16:84200507-84200529 GTCTCTCTCTATATAGGGGTAGG - Intergenic
1141952323 16:87346928-87346950 GACTCTCTGGTCTGAGGGGGTGG - Intronic
1143413719 17:6729343-6729365 GTCTCACTCTTCAGGGCGGTGGG - Intergenic
1145901197 17:28491462-28491484 GTCTGCCTCTTCGGAGGGGAGGG + Exonic
1151305644 17:73261293-73261315 GTCTCTCTCTTCTGTGGCTTCGG - Intronic
1151488522 17:74417788-74417810 GGCTCTCTCTTCTCAGGGTCAGG - Intergenic
1151817999 17:76481046-76481068 CAGTCTCTCTTCTGAGGGCTGGG - Intronic
1151830134 17:76544639-76544661 GTCTCTCTCTTTGGAGGCATCGG + Intronic
1152016928 17:77756895-77756917 GTCTCTCGCCTCTGTGGGCTCGG - Intergenic
1152382760 17:79950664-79950686 CTCTCTCTCTTCTGAAAGGAGGG + Intronic
1153244385 18:3059122-3059144 GTTTTTCTCTTTTGTGGGGTGGG - Intergenic
1155304658 18:24467326-24467348 GTCTGTCTCTCCTGAGGATTAGG - Intronic
1155995467 18:32326650-32326672 GTCGGTCTCTTGTGAGGGGGTGG - Intronic
1157020209 18:43772321-43772343 GTCACTCTCTGGTGAGGGCTTGG - Intergenic
1157224425 18:45849685-45849707 GTCTCTCACTTCTTTGAGGTTGG - Exonic
1158411542 18:57210187-57210209 TTATCTCACTTCTGAGGGCTGGG + Intergenic
1158936514 18:62369500-62369522 GTCTCTCACTTCTGAGCAGAAGG + Intronic
1159478749 18:68959870-68959892 GTCTCTCTCTTCAGGGTAGTGGG + Intronic
1159640975 18:70862464-70862486 GTCTCTTTATTCTGTTGGGTAGG + Intergenic
1162657274 19:12140429-12140451 GTCACTCAGTTCTGAGGGGGCGG - Intronic
1165637461 19:37354086-37354108 TTTTCTCTTTTTTGAGGGGTGGG + Intronic
1166720698 19:44994327-44994349 GCCTCTGTGTTCTGAGGGCTGGG + Intergenic
1168419299 19:56190782-56190804 GTCCCTCTCTTCTGGGGTGCGGG - Intronic
1168421689 19:56208218-56208240 GCCCCTCTCTTCTGGGGTGTGGG + Intronic
1168423753 19:56222536-56222558 GTCCCTCTCTTCTGGGGTGCGGG - Intronic
1168426955 19:56246499-56246521 GCCCCTCTCTTCTGGGGTGTGGG + Intronic
931216915 2:60253792-60253814 TTCTCTCTGACCTGAGGGGTTGG - Intergenic
933648619 2:84831600-84831622 GTCTCACCCTTCTCAGGGGCAGG - Intronic
935788861 2:106572320-106572342 GCTTCTGTCTGCTGAGGGGTCGG - Intergenic
938791142 2:134677334-134677356 GTCTTTCTCTTATAAGGAGTGGG - Intronic
940336127 2:152529360-152529382 TTCTTTTTCTTCTGAGGTGTGGG - Intronic
940685989 2:156851660-156851682 GTCTGTCTTTTCTGGGAGGTGGG - Intergenic
943740764 2:191405695-191405717 TTCTCTCTTTTCTGAGCAGTAGG + Intronic
943989294 2:194666101-194666123 GTCTATCTTTGCTCAGGGGTAGG + Intergenic
945082062 2:206096172-206096194 GTCTCTCTCTATTGAGGAGGAGG + Intergenic
947189391 2:227486247-227486269 GTCTTTCTTTTCTGTGGGGTGGG + Intronic
1169075672 20:2758677-2758699 GTCTCTCTCTTGAGGGAGGTAGG + Intronic
1169898240 20:10526940-10526962 GTCTCTCTCTTTTTTGGGATGGG - Intronic
1172117113 20:32579641-32579663 GTCACTGTCTGCTGAGGGGTGGG - Intronic
1173072164 20:39778883-39778905 GCCTCCCTCTTCTGTGAGGTGGG - Intergenic
1173469815 20:43314364-43314386 GTCTCTCTGCTCTGAGAGCTGGG + Intergenic
1173527445 20:43744010-43744032 GTTTCTATCCTCTGAGGGATGGG - Intergenic
1175334324 20:58185307-58185329 GTGTGTCCCTTCTGAGGGGAGGG - Intergenic
1177480930 21:21687099-21687121 GTCTGTATCTGGTGAGGGGTAGG + Intergenic
1178315950 21:31566967-31566989 GTGCCTCTCTTCTTGGGGGTAGG + Intergenic
1181055300 22:20258094-20258116 GGCTTTCTCCTCTGTGGGGTGGG - Intronic
1181960171 22:26617054-26617076 GTCTGCTTCCTCTGAGGGGTTGG + Intronic
1183353927 22:37348634-37348656 GTCTCTCTCTCCTGAAGAATGGG + Intergenic
1184357199 22:43990249-43990271 GTCTTTCTCTTTTCAGGGGAGGG + Exonic
1185266358 22:49906341-49906363 CTCCCTCTCGTCTCAGGGGTCGG - Intronic
950048021 3:9962548-9962570 GTCTCTCTCTTGTGAGTTGAGGG + Exonic
950490074 3:13299234-13299256 ATCTCCCTTTTTTGAGGGGTGGG - Intergenic
952533674 3:34288383-34288405 CTCTCTCTCTCCTGAGGTGATGG + Intergenic
952635324 3:35522397-35522419 GTTTTTCTCTTGTGAGGGTTTGG - Intergenic
953737706 3:45510430-45510452 GTCTTTCTCCTGTGAGGAGTAGG - Intronic
954131070 3:48561175-48561197 TTCTCTCTCTTCAGAGTGCTAGG - Intronic
954885031 3:53865309-53865331 GTCTCTTGCTTCTCATGGGTGGG - Exonic
955992781 3:64645865-64645887 TTTTCTATCTTCTGAGGGATGGG - Intronic
959817118 3:110686779-110686801 GTCACTCATTTCTGAGAGGTTGG - Intergenic
959905178 3:111703327-111703349 CTCTCCCTCTTCTGTGGGATGGG + Intronic
960179729 3:114561581-114561603 ATCTCTTTTTTCTGAGTGGTAGG + Intronic
960350898 3:116591389-116591411 GTCTCTCACTTCAAAGGTGTTGG - Intronic
960974505 3:123161485-123161507 CTCTCTCTCTGCTGATGGGCAGG + Intronic
961333680 3:126157601-126157623 GGCCCTCTCTTCCCAGGGGTAGG + Intronic
961636717 3:128337616-128337638 GTCACTCTCTTCAGAGCGGCTGG + Intronic
961695083 3:128698675-128698697 GTCTCTTTTTCCTCAGGGGTCGG + Intergenic
961955129 3:130793858-130793880 TTCTCTTTCTTCAGAGTGGTTGG - Intergenic
962407173 3:135110354-135110376 GTGTCCCTCATCTAAGGGGTCGG - Intronic
962654493 3:137529511-137529533 GTCTCTTTCTTTGGAGGGGAGGG - Intergenic
962684173 3:137830560-137830582 GTCTGTCCCTTCTGAGGAGACGG - Intergenic
963093455 3:141509354-141509376 GTCTCTCTCTTAAGAGGGAGAGG + Intronic
964611484 3:158620782-158620804 GTTTCTCTCTCCTGAGGTGAGGG + Intergenic
964786358 3:160400244-160400266 GTCTCCCTCCTCTCAGCGGTCGG - Intronic
966394020 3:179482759-179482781 GACTCTCTCTTTTGAGGTGAGGG + Intergenic
967038144 3:185663445-185663467 GTTTGACTCTTCTGGGGGGTAGG + Intronic
967061737 3:185878904-185878926 GCCTCTAGCTTCAGAGGGGTTGG - Intergenic
968193848 3:196690791-196690813 CTCTCTCTCTTCCCTGGGGTGGG - Intronic
968414273 4:416493-416515 GTTTCTCTTTTCTGCGTGGTGGG + Intergenic
969877712 4:10148249-10148271 CTCGCTCTCAGCTGAGGGGTGGG - Intergenic
970804715 4:20017469-20017491 TTCTCTCTCCTCTCAGGAGTGGG - Intergenic
971328589 4:25664187-25664209 GTCTCTCTCTGCAGGGGGGTGGG - Exonic
972165415 4:36277736-36277758 GTCTCTAGCTTCTGATGTGTGGG + Intergenic
977073204 4:92418993-92419015 GTCTCTTTCTTTTGAAGGTTTGG + Intronic
979277978 4:118835088-118835110 GTCTCTCTCTGCTAAGTGGGAGG - Intronic
979679421 4:123443531-123443553 GTTTCTCTTTTTTGAGGGGGTGG - Intergenic
980252069 4:130330369-130330391 GTTTGTCTCTTCAGAGGGTTGGG - Intergenic
982610347 4:157566364-157566386 GTCTCTCTCCTCTGAGGAAGAGG - Intergenic
984932093 4:184857153-184857175 CTGTCTGTCTTCTGTGGGGTGGG - Intergenic
985267656 4:188165008-188165030 TTTTCTCTCTGCTGAGGTGTAGG - Intergenic
985762055 5:1754237-1754259 GTGTCTCCCTGCTGAGGGGTTGG - Intergenic
987602288 5:20086746-20086768 GTCTTTCTTTTCTGAGCAGTAGG - Intronic
988528241 5:32004934-32004956 GCCTCACTCTTCTGAGGCCTGGG - Intronic
988675855 5:33432249-33432271 TTCTCTCTCTTCAGATAGGTAGG + Intergenic
989112076 5:37915994-37916016 TTCTCTGTCTTCGGAGGGGAAGG + Intergenic
989224132 5:39006196-39006218 TTCTCTCTTTTCTGAAAGGTTGG + Intronic
990719936 5:58683088-58683110 TTCTCTCTGTTCTCAGGGCTAGG + Intronic
991939706 5:71838750-71838772 GTCTGCCACCTCTGAGGGGTAGG - Intergenic
991945372 5:71894147-71894169 GTTTCTCTCTTCTGACAGGGAGG + Intergenic
993092018 5:83437956-83437978 GTCTGTCTCTTCGGAGCTGTTGG - Intergenic
993157499 5:84244308-84244330 GTCTCTCTCTTTTGCCAGGTTGG + Intronic
993209397 5:84928773-84928795 GTGTCTGTCTTCTGCAGGGTGGG - Intergenic
993312689 5:86356107-86356129 TTCTCACACTTCTGAGGGCTGGG + Intergenic
993963426 5:94330794-94330816 CTCTCTCTCTTTTGAGGGGAAGG - Intronic
994312715 5:98293734-98293756 GTCTCTGTCTTTTGAGGGATTGG - Intergenic
994749214 5:103717992-103718014 GTCTCTCTATTCAGTGAGGTTGG + Intergenic
997124178 5:131209374-131209396 GTCTCTCTCTAGGGAAGGGTTGG + Intergenic
997212702 5:132086794-132086816 CTCTCTCTCTTCTCAGGGCTAGG + Intergenic
997464361 5:134077465-134077487 ATCCCTCTCTCCTGAGGAGTAGG - Intergenic
997847177 5:137297574-137297596 GTCTCTCTTTTGTGAGGGGAGGG + Intronic
998288554 5:140888681-140888703 GTCTCTCTTCTCTGATTGGTAGG + Intronic
998524353 5:142828738-142828760 GTCTCTATATTTTGAGGGGTTGG + Intronic
1000272899 5:159703559-159703581 TTCCCTCTCTTCTAAGTGGTGGG + Intergenic
1001905509 5:175469438-175469460 GTCACTCACTTCTGAGTGCTTGG - Intergenic
1001957054 5:175854960-175854982 GTTTATCTCTTCTGCTGGGTGGG - Intronic
1002874479 6:1199526-1199548 GTCTCTCTCCACTGGAGGGTAGG - Intergenic
1006473776 6:34242645-34242667 GGCTGTGTCTTCTGAGGGGGTGG + Intronic
1007340969 6:41191459-41191481 CTCTCTCTATCCTGAGGGGTAGG + Exonic
1010587642 6:77673479-77673501 GGCCCTCTCTTCTGAAGGCTAGG + Intergenic
1011023947 6:82845729-82845751 GTCTCTCCTTTCAGAGCGGTGGG - Intergenic
1014141264 6:117945897-117945919 GTCTCTCTCTTTTGATGTTTTGG - Intronic
1017266917 6:152457454-152457476 GTCTCTCTCCTCTGATGGACAGG + Intronic
1019018487 6:168897832-168897854 CTCTCTCTCTTTTGTGGGGAGGG + Intergenic
1023510216 7:40944944-40944966 TTCACTATCTTCTGTGGGGTTGG + Intergenic
1023824222 7:43997893-43997915 GTCTGTCTCTGCTGAGGGTGGGG - Intergenic
1027327875 7:77062540-77062562 GTCTGTCTCTGCTGAGGGTGGGG + Intergenic
1029752487 7:102551222-102551244 GTCTGTCTCTGCTGAGGGTGGGG - Exonic
1029770439 7:102650315-102650337 GTCTGTCTCTGCTGAGGGTGGGG - Exonic
1031546148 7:123053385-123053407 GTCTCTCTCTTCAGGGCAGTGGG + Intergenic
1032748520 7:134812519-134812541 GTCTCTCATCTCTGAAGGGTGGG - Intronic
1034671467 7:152862109-152862131 GTCCCTCTCTTCTGCTGGGATGG - Intergenic
1035823542 8:2620495-2620517 CTCTCTCTCTTGTGAGAGATTGG + Intergenic
1038499265 8:28029931-28029953 GGCTCTGTCGTTTGAGGGGTAGG - Intronic
1040972415 8:53151028-53151050 TTTTCTCTCTTCTGAGAGGTGGG - Intergenic
1041597357 8:59671433-59671455 TTCTCTTTCTTTTGAGGGGAGGG - Intergenic
1041860557 8:62508264-62508286 GTCCCTCTGTTGTGAAGGGTTGG - Intronic
1042461906 8:69079733-69079755 CTCTCTCTCTTGTGATGTGTAGG - Intergenic
1046503710 8:115111282-115111304 GTCTCTCTTTGCTGAGAGATGGG - Intergenic
1046924530 8:119771701-119771723 GTCAATCTCTTCTTAGGTGTAGG - Intronic
1048304686 8:133275693-133275715 GACTCTTTCTTCTGAGGAATCGG + Intronic
1050372806 9:4939322-4939344 GTCCCTCTCTTCTTGAGGGTGGG - Intergenic
1051342129 9:16121327-16121349 GTCTCTCTCTGGAGAGGGGCTGG + Intergenic
1052209031 9:25879247-25879269 GTCACTTTCTTCTGTTGGGTTGG - Intergenic
1053284622 9:36842215-36842237 TATTCTCTCTTCTGAGGGATGGG + Intronic
1054895880 9:70310407-70310429 GTCTTTTTTTTCTGAGGAGTAGG + Intronic
1055120663 9:72656936-72656958 GTCTTTCTCCTCTGACTGGTTGG + Intronic
1058154793 9:101503080-101503102 CTCTCTCACTTCTCAGGGTTGGG + Intronic
1060923545 9:127439570-127439592 GTCTGTCACTTGGGAGGGGTAGG - Intronic
1061040388 9:128138300-128138322 GTCTCGCTCTCCTGAGGGGTGGG - Intergenic
1061129721 9:128702286-128702308 GTCTCTCTCCTCGGAGTGGTTGG - Intergenic
1062204994 9:135331399-135331421 TGCTCTCTCCTCTCAGGGGTGGG - Intergenic
1062447975 9:136603684-136603706 GTCTCTGCCTTCTGACTGGTGGG - Intergenic
1187076119 X:15937014-15937036 GTTTCTCTCTTCTGAGAATTTGG - Intergenic
1187132800 X:16518549-16518571 GTCTCTCTCTTCAGGGCAGTGGG - Intergenic
1192207374 X:69105393-69105415 CTCTCTCGCTTTTGAGGGGAAGG - Intergenic
1192258647 X:69489359-69489381 GTCTATTTCTTCTGTTGGGTGGG - Intergenic
1193092593 X:77510557-77510579 GTCTCTCCCTTCTGGGCAGTGGG - Intronic
1195687792 X:107601712-107601734 GTCTCCTTCTTCTGGCGGGTTGG - Exonic
1195739679 X:108050940-108050962 GTTTCTTTCTTCTGCTGGGTGGG - Intronic
1196930950 X:120681601-120681623 GTCTCTCTCTTTTAAGAGATGGG - Intergenic
1197359168 X:125477319-125477341 TTCTTTCAATTCTGAGGGGTAGG + Intergenic
1198130086 X:133685344-133685366 TTCTCTCTCTTCTGCTGGGTTGG - Intronic
1198248863 X:134859950-134859972 GTCTCCCTCTTCTGAGAGGAAGG + Intergenic
1199720469 X:150539793-150539815 GTCTCCCTTTCCTGAGTGGTGGG + Intergenic
1200180317 X:154146321-154146343 GTGTCTCTTTTCTGGGGTGTTGG + Intronic
1200186145 X:154184716-154184738 GTGTCTCTTTTCTGGGGTGTTGG + Intergenic
1200191797 X:154221854-154221876 GTGTCTCTTTTCTGGGGTGTTGG + Intronic
1200197552 X:154259658-154259680 GTGTCTCTTTTCTGGGGTGTTGG + Intronic
1201324531 Y:12741508-12741530 GCCTTTGTCTTCTGAGGTGTTGG + Intronic
1201448648 Y:14085263-14085285 CTCTCTCCCTTCTCAGTGGTGGG - Intergenic