ID: 917567173 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:176224863-176224885 |
Sequence | GTTGAGTGCTTGGTGAAGTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
917567173_917567180 | -9 | Left | 917567173 | 1:176224863-176224885 | CCCCACTTCACCAAGCACTCAAC | No data | ||
Right | 917567180 | 1:176224877-176224899 | GCACTCAACTCCCAGGGCAAGGG | No data | ||||
917567173_917567179 | -10 | Left | 917567173 | 1:176224863-176224885 | CCCCACTTCACCAAGCACTCAAC | No data | ||
Right | 917567179 | 1:176224876-176224898 | AGCACTCAACTCCCAGGGCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
917567173 | Original CRISPR | GTTGAGTGCTTGGTGAAGTG GGG (reversed) | Intergenic | ||