ID: 917567173

View in Genome Browser
Species Human (GRCh38)
Location 1:176224863-176224885
Sequence GTTGAGTGCTTGGTGAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917567173_917567180 -9 Left 917567173 1:176224863-176224885 CCCCACTTCACCAAGCACTCAAC No data
Right 917567180 1:176224877-176224899 GCACTCAACTCCCAGGGCAAGGG No data
917567173_917567179 -10 Left 917567173 1:176224863-176224885 CCCCACTTCACCAAGCACTCAAC No data
Right 917567179 1:176224876-176224898 AGCACTCAACTCCCAGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917567173 Original CRISPR GTTGAGTGCTTGGTGAAGTG GGG (reversed) Intergenic