ID: 917577239

View in Genome Browser
Species Human (GRCh38)
Location 1:176336414-176336436
Sequence GAGTGTGGCAAATGGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917577231_917577239 28 Left 917577231 1:176336363-176336385 CCAGTGGATTGGCATGATCAGAT No data
Right 917577239 1:176336414-176336436 GAGTGTGGCAAATGGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917577239 Original CRISPR GAGTGTGGCAAATGGATGGA GGG Intergenic
No off target data available for this crispr