ID: 917582171

View in Genome Browser
Species Human (GRCh38)
Location 1:176390330-176390352
Sequence CTGGAGTACCTGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917582171_917582176 16 Left 917582171 1:176390330-176390352 CCCTTCTCCTTCAGGTACTCCAG No data
Right 917582176 1:176390369-176390391 TACTTTTACATAGTCCCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917582171 Original CRISPR CTGGAGTACCTGAAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr