ID: 917583722

View in Genome Browser
Species Human (GRCh38)
Location 1:176403780-176403802
Sequence GTTGATGATCAGATGGCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917583715_917583722 28 Left 917583715 1:176403729-176403751 CCATTTATTAAATAGGGAATCCT 0: 12666
1: 6533
2: 3352
3: 2822
4: 3159
Right 917583722 1:176403780-176403802 GTTGATGATCAGATGGCTATTGG No data
917583717_917583722 3 Left 917583717 1:176403754-176403776 CCCCATTGCTTGTTTTTGTCAGG 0: 4015
1: 12428
2: 5521
3: 2208
4: 1429
Right 917583722 1:176403780-176403802 GTTGATGATCAGATGGCTATTGG No data
917583719_917583722 2 Left 917583719 1:176403755-176403777 CCCATTGCTTGTTTTTGTCAGGT 0: 4181
1: 12566
2: 5478
3: 2083
4: 1483
Right 917583722 1:176403780-176403802 GTTGATGATCAGATGGCTATTGG No data
917583720_917583722 1 Left 917583720 1:176403756-176403778 CCATTGCTTGTTTTTGTCAGGTT 0: 4280
1: 12602
2: 5328
3: 2020
4: 1596
Right 917583722 1:176403780-176403802 GTTGATGATCAGATGGCTATTGG No data
917583716_917583722 8 Left 917583716 1:176403749-176403771 CCTTTCCCCATTGCTTGTTTTTG 0: 4153
1: 12264
2: 5516
3: 2668
4: 3653
Right 917583722 1:176403780-176403802 GTTGATGATCAGATGGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917583722 Original CRISPR GTTGATGATCAGATGGCTAT TGG Intergenic
No off target data available for this crispr