ID: 917583722 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:176403780-176403802 |
Sequence | GTTGATGATCAGATGGCTAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
917583715_917583722 | 28 | Left | 917583715 | 1:176403729-176403751 | CCATTTATTAAATAGGGAATCCT | 0: 12666 1: 6533 2: 3352 3: 2822 4: 3159 |
||
Right | 917583722 | 1:176403780-176403802 | GTTGATGATCAGATGGCTATTGG | No data | ||||
917583717_917583722 | 3 | Left | 917583717 | 1:176403754-176403776 | CCCCATTGCTTGTTTTTGTCAGG | 0: 4015 1: 12428 2: 5521 3: 2208 4: 1429 |
||
Right | 917583722 | 1:176403780-176403802 | GTTGATGATCAGATGGCTATTGG | No data | ||||
917583719_917583722 | 2 | Left | 917583719 | 1:176403755-176403777 | CCCATTGCTTGTTTTTGTCAGGT | 0: 4181 1: 12566 2: 5478 3: 2083 4: 1483 |
||
Right | 917583722 | 1:176403780-176403802 | GTTGATGATCAGATGGCTATTGG | No data | ||||
917583720_917583722 | 1 | Left | 917583720 | 1:176403756-176403778 | CCATTGCTTGTTTTTGTCAGGTT | 0: 4280 1: 12602 2: 5328 3: 2020 4: 1596 |
||
Right | 917583722 | 1:176403780-176403802 | GTTGATGATCAGATGGCTATTGG | No data | ||||
917583716_917583722 | 8 | Left | 917583716 | 1:176403749-176403771 | CCTTTCCCCATTGCTTGTTTTTG | 0: 4153 1: 12264 2: 5516 3: 2668 4: 3653 |
||
Right | 917583722 | 1:176403780-176403802 | GTTGATGATCAGATGGCTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
917583722 | Original CRISPR | GTTGATGATCAGATGGCTAT TGG | Intergenic | ||
No off target data available for this crispr |