ID: 917585371

View in Genome Browser
Species Human (GRCh38)
Location 1:176421279-176421301
Sequence TCATACTGCATAGGTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917585371_917585376 25 Left 917585371 1:176421279-176421301 CCAGTTTTACCTATGCAGTATGA No data
Right 917585376 1:176421327-176421349 ACTCTTATTATTTTTACATATGG No data
917585371_917585375 -10 Left 917585371 1:176421279-176421301 CCAGTTTTACCTATGCAGTATGA No data
Right 917585375 1:176421292-176421314 TGCAGTATGATGTTGGCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917585371 Original CRISPR TCATACTGCATAGGTAAAAC TGG (reversed) Intergenic
No off target data available for this crispr