ID: 917585375

View in Genome Browser
Species Human (GRCh38)
Location 1:176421292-176421314
Sequence TGCAGTATGATGTTGGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917585366_917585375 25 Left 917585366 1:176421244-176421266 CCTTATCTTGTGCTGGTTTACAA No data
Right 917585375 1:176421292-176421314 TGCAGTATGATGTTGGCTATGGG No data
917585371_917585375 -10 Left 917585371 1:176421279-176421301 CCAGTTTTACCTATGCAGTATGA No data
Right 917585375 1:176421292-176421314 TGCAGTATGATGTTGGCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917585375 Original CRISPR TGCAGTATGATGTTGGCTAT GGG Intergenic
No off target data available for this crispr