ID: 917588459

View in Genome Browser
Species Human (GRCh38)
Location 1:176452464-176452486
Sequence GTGTAGCAGGAGAGGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917588451_917588459 9 Left 917588451 1:176452432-176452454 CCACTTGGGTGGAGTGAAGTGAC No data
Right 917588459 1:176452464-176452486 GTGTAGCAGGAGAGGCAGAGAGG No data
917588450_917588459 10 Left 917588450 1:176452431-176452453 CCCACTTGGGTGGAGTGAAGTGA No data
Right 917588459 1:176452464-176452486 GTGTAGCAGGAGAGGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917588459 Original CRISPR GTGTAGCAGGAGAGGCAGAG AGG Intergenic
No off target data available for this crispr