ID: 917589167

View in Genome Browser
Species Human (GRCh38)
Location 1:176459412-176459434
Sequence TGACCTCTGGAGCCCCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917589157_917589167 14 Left 917589157 1:176459375-176459397 CCTGTACCATCCCATGGCAGCAT No data
Right 917589167 1:176459412-176459434 TGACCTCTGGAGCCCCAAAGGGG No data
917589163_917589167 3 Left 917589163 1:176459386-176459408 CCATGGCAGCATCTAGGGGTTGT No data
Right 917589167 1:176459412-176459434 TGACCTCTGGAGCCCCAAAGGGG No data
917589162_917589167 4 Left 917589162 1:176459385-176459407 CCCATGGCAGCATCTAGGGGTTG No data
Right 917589167 1:176459412-176459434 TGACCTCTGGAGCCCCAAAGGGG No data
917589154_917589167 29 Left 917589154 1:176459360-176459382 CCAACAGGAATGAACCCTGTACC No data
Right 917589167 1:176459412-176459434 TGACCTCTGGAGCCCCAAAGGGG No data
917589156_917589167 15 Left 917589156 1:176459374-176459396 CCCTGTACCATCCCATGGCAGCA No data
Right 917589167 1:176459412-176459434 TGACCTCTGGAGCCCCAAAGGGG No data
917589159_917589167 8 Left 917589159 1:176459381-176459403 CCATCCCATGGCAGCATCTAGGG No data
Right 917589167 1:176459412-176459434 TGACCTCTGGAGCCCCAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917589167 Original CRISPR TGACCTCTGGAGCCCCAAAG GGG Intergenic
No off target data available for this crispr