ID: 917589633

View in Genome Browser
Species Human (GRCh38)
Location 1:176463025-176463047
Sequence TGGGTGTTCCCGGACTATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917589633_917589636 -6 Left 917589633 1:176463025-176463047 CCGTGATAGTCCGGGAACACCCA 0: 1
1: 0
2: 0
3: 4
4: 43
Right 917589636 1:176463042-176463064 CACCCAAATTGGTGTAAAAATGG 0: 1
1: 0
2: 1
3: 11
4: 187
917589633_917589637 -5 Left 917589633 1:176463025-176463047 CCGTGATAGTCCGGGAACACCCA 0: 1
1: 0
2: 0
3: 4
4: 43
Right 917589637 1:176463043-176463065 ACCCAAATTGGTGTAAAAATGGG 0: 1
1: 0
2: 3
3: 8
4: 223
917589633_917589640 -2 Left 917589633 1:176463025-176463047 CCGTGATAGTCCGGGAACACCCA 0: 1
1: 0
2: 0
3: 4
4: 43
Right 917589640 1:176463046-176463068 CAAATTGGTGTAAAAATGGGTGG 0: 1
1: 0
2: 3
3: 49
4: 276
917589633_917589641 13 Left 917589633 1:176463025-176463047 CCGTGATAGTCCGGGAACACCCA 0: 1
1: 0
2: 0
3: 4
4: 43
Right 917589641 1:176463061-176463083 ATGGGTGGTACCACAGTTCCAGG 0: 1
1: 1
2: 2
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917589633 Original CRISPR TGGGTGTTCCCGGACTATCA CGG (reversed) Intergenic
902573865 1:17364470-17364492 TGGGTGTTCTCTGAATATCTTGG - Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
907480090 1:54739594-54739616 GAGGTGTTCCTGGACTATAAGGG + Intronic
917589633 1:176463025-176463047 TGGGTGTTCCCGGACTATCACGG - Intergenic
1066082050 10:31940928-31940950 TGGGTGTTCCAAGACACTCATGG - Intergenic
1067294386 10:44966653-44966675 TGGGTGTTCTGGAACTGTCATGG + Intronic
1080786022 11:35475779-35475801 TGGCTGTTTTTGGACTATCATGG + Intronic
1086542926 11:87934088-87934110 TGAGTGGTCCAGGACAATCACGG - Intergenic
1095926126 12:47581337-47581359 TGGGTGTTCCCCAAATGTCACGG - Intergenic
1098124516 12:67276400-67276422 TGTGTTTTCCCTGACTATTACGG - Intronic
1104402473 12:128487764-128487786 AGGGTGTTCCTTGACTATGAAGG - Intronic
1106627035 13:31431354-31431376 TGGGTTTTCCAGGTCTCTCAGGG + Intergenic
1119790980 14:77349499-77349521 GGGGTGTTTGAGGACTATCAAGG - Intronic
1120317926 14:82919987-82920009 TTGGTGTTCCCGGCCTATGTGGG - Intergenic
1122506182 14:102233279-102233301 GAGGTGTTCCCGGACTCTTAGGG - Intronic
1123063293 14:105604148-105604170 TGGGTGCTCGTGGACTATCCGGG - Intergenic
1123087355 14:105722934-105722956 TGGGTGCTCGTGGACTATCCGGG - Intergenic
1123780508 15:23622283-23622305 TTGGAGTTCCCGGACTAGTAGGG - Intronic
1124591914 15:31061231-31061253 TGGGTGCTCCTGGACCATCATGG - Intronic
1135608930 16:23847994-23848016 TGGGAGTTCCCGGATTGACAAGG + Intronic
1143759325 17:9089680-9089702 TGGGTGCTTTCGGACTCTCAGGG + Intronic
1143886585 17:10069406-10069428 CTGGTGTTCCTGGACTAGCAAGG - Intronic
1159119013 18:64148054-64148076 TGGGTTTTCCAGGTCTTTCAAGG + Intergenic
1162411097 19:10505784-10505806 AGCGTGTTCACGGACTATCTAGG - Intergenic
942284681 2:174404142-174404164 TGGGTGTTCCCGGGCAATCTTGG - Exonic
1169206096 20:3741082-3741104 TGGGTGACCCTGGACTATAAAGG + Intronic
1177893213 21:26832258-26832280 TGCGTGTGCTGGGACTATCAAGG - Intergenic
961253205 3:125523794-125523816 TTGGTGTTCCCAGGCTAACATGG - Intergenic
966643424 3:182215856-182215878 TGTGTGTTCCAGGCCTGTCATGG - Intergenic
977116631 4:93036721-93036743 TCAGTGTTCCCATACTATCAGGG + Intronic
977817721 4:101434481-101434503 TTGGTGTTCCCTGCTTATCAGGG + Intronic
996725947 5:126673532-126673554 TGGAAGCTCCGGGACTATCACGG - Intergenic
1002685443 5:181005693-181005715 GGGGTCTTCCTGGACTATGAGGG + Exonic
1003696411 6:8410175-8410197 TGGGTGTTCCAGGACAGTGATGG - Intergenic
1005808705 6:29500230-29500252 GGGGTGTTCCCTGCCAATCAGGG + Intergenic
1030194632 7:106841519-106841541 TGGGACTTCCAGGACTATAATGG - Intergenic
1036638058 8:10564964-10564986 TGGGGGTTCCTGATCTATCAGGG + Intergenic
1043374588 8:79634393-79634415 TGGATGTTCCAGGACTTTTATGG + Intronic
1045528442 8:102961537-102961559 TGGGTGTAGCCGCAGTATCAAGG - Intronic
1053462208 9:38279723-38279745 TGGGTGTTCCAGAACTGTTATGG + Intergenic
1056716282 9:89032813-89032835 TGGTTGGTCCCTGACTATAAAGG - Intronic
1059393785 9:114017765-114017787 TGGGCCTTCCCAGACTATAAGGG - Intronic
1061767645 9:132891892-132891914 TGGGGGTTCTCAGACTCTCAGGG + Exonic
1061924814 9:133800788-133800810 TGGGTGTTCCCGGTAGAGCATGG - Intronic
1187207777 X:17199021-17199043 TGGGGGAACCCAGACTATCAGGG + Intergenic
1192632495 X:72788252-72788274 TGGCTGTTCCAGGACTAACAAGG + Intronic
1192649214 X:72932549-72932571 TGGCTGTTCCAGGACTAACAAGG - Intronic
1196792417 X:119476378-119476400 TGGCTTTTCCGTGACTATCAGGG + Intergenic