ID: 917593699

View in Genome Browser
Species Human (GRCh38)
Location 1:176505233-176505255
Sequence GAGGACAAAATAGCCTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917593699 Original CRISPR GAGGACAAAATAGCCTTGGA AGG (reversed) Intronic
900885094 1:5409536-5409558 GAAGACAAAATGGCCTGAGAGGG - Intergenic
902513548 1:16978624-16978646 GAGGACAGAATGGCCTGGGCTGG - Intronic
902989163 1:20174141-20174163 GAGGACCTCAGAGCCTTGGAAGG - Intronic
904163162 1:28536126-28536148 GATGACAAAACTGGCTTGGAGGG - Intronic
905772235 1:40645839-40645861 GATGAGAAAATAGCTCTGGATGG - Intronic
906862451 1:49376250-49376272 GAGTACAAAATAGATCTGGAAGG - Intronic
908605393 1:65792638-65792660 GGGGAAAAAATAACCTGGGAGGG + Intronic
913596742 1:120385914-120385936 GAGAAAAAAATAGCTCTGGAGGG + Intergenic
914308080 1:146441155-146441177 GAGAAAAAAATAGCTCTGGAGGG + Intergenic
914594028 1:149131978-149132000 GAGAAAAAAATAGCTCTGGAGGG - Intergenic
914882496 1:151558335-151558357 GAAGAGAAAATAACCTTTGAGGG + Intronic
915681814 1:157588848-157588870 GAGGACAAAAGTGCCATCGAAGG - Intronic
917593699 1:176505233-176505255 GAGGACAAAATAGCCTTGGAAGG - Intronic
919629120 1:199942871-199942893 TAGGAGAAAAATGCCTTGGATGG + Intergenic
923061490 1:230479139-230479161 GAGGACAACATAGGCATGGAAGG - Intergenic
923694549 1:236234697-236234719 GAGAACCAAATAGACTTGGAAGG - Intronic
1063846329 10:10131521-10131543 GAGGACAATGAAGCCCTGGAAGG + Intergenic
1063860642 10:10304045-10304067 GAGACCAAAATCTCCTTGGAAGG - Intergenic
1070305434 10:75236224-75236246 GAGGAGAAAAAAGCATTGGCAGG - Intergenic
1070342389 10:75509943-75509965 GAGGAAAAAATAGACTGGGTGGG - Intronic
1070511058 10:77161012-77161034 GTGGATGAAAGAGCCTTGGAGGG - Intronic
1071375498 10:84998307-84998329 AAGTACTAAATAGCCTAGGATGG - Intergenic
1072671369 10:97432283-97432305 GAGGACAAAGTAAACCTGGAGGG + Intronic
1072853048 10:98917123-98917145 AATGATAAAATAGTCTTGGATGG - Intronic
1073642901 10:105270918-105270940 GAAGCCAAGATAGCTTTGGAGGG + Intergenic
1075195105 10:120349594-120349616 GAAGAAAAAATAGCCTGGAATGG + Intergenic
1075885885 10:125898625-125898647 GAGGAAAAAACAGGGTTGGAAGG + Intronic
1078406347 11:11073325-11073347 GAGAACAAAACAGGTTTGGAAGG + Intergenic
1080757332 11:35214702-35214724 GATGGCAAAACAGCCTTGAATGG - Intronic
1084476736 11:69393738-69393760 GGGGACATATTAGCCTTGAAGGG - Intergenic
1089275463 11:117332679-117332701 GAGGATAAAATTGGCTGGGAAGG + Intronic
1089876242 11:121724440-121724462 GAGGACAAGATTGCCTTTAATGG + Intergenic
1092968993 12:13673346-13673368 GAGGAGAATAAAGGCTTGGAAGG + Intronic
1093450897 12:19312385-19312407 GTAGACGAAATAGCCTTGTATGG - Intronic
1095691067 12:45089212-45089234 AATGACAAAAAATCCTTGGAGGG + Intergenic
1096161541 12:49382402-49382424 CAGCACAAAATATCTTTGGAAGG - Intronic
1096436647 12:51596617-51596639 GAGGGCAAAAGTGCCTTTGAAGG + Intronic
1097386853 12:58960271-58960293 CAGGACAAAATACCTTTTGAGGG + Intergenic
1099864538 12:88262899-88262921 GAGGATAAAATAATCTTTGAAGG - Intergenic
1100959197 12:99944063-99944085 GAAGAGAAAATAACCTTGGGTGG - Intronic
1102909317 12:116700338-116700360 CAGGACAAAATAGGCTTGCGTGG + Intergenic
1105642754 13:22282992-22283014 GAAGACAACATAGCTTTGGAGGG - Intergenic
1107442506 13:40440692-40440714 GAGCAGAAAACAGCCTGGGATGG - Intergenic
1107740660 13:43446593-43446615 GAAGGCAGAATAGCCATGGAGGG - Intronic
1112275531 13:98014643-98014665 GAGGGTAAATTTGCCTTGGAAGG + Intronic
1112649061 13:101371654-101371676 GAGGACAAAATAAATTTGGTAGG + Intronic
1112911862 13:104495315-104495337 GAGGAAAAAATTGACATGGATGG + Intergenic
1115316596 14:32031349-32031371 AAGAACAAAATATCCTTTGAAGG + Intergenic
1115443931 14:33467636-33467658 GAGGCCAAAATAGCCGGGGGAGG - Intronic
1117496374 14:56309506-56309528 GAGCTCTAGATAGCCTTGGAGGG - Intergenic
1119236525 14:73024772-73024794 GTGGTCAAAATTGACTTGGAAGG + Exonic
1120891115 14:89492205-89492227 GGGGACCAAATAGCATTGGTAGG - Intronic
1128236223 15:66069202-66069224 CAGGACCAAACAGACTTGGACGG - Intronic
1128923321 15:71631655-71631677 GAGGCCGAAATAGCCCAGGAGGG + Intronic
1130966840 15:88704138-88704160 GGGGACACAAGAGCCTTTGAGGG - Intergenic
1132034162 15:98466611-98466633 GAGTATAATATAGCCTTTGAGGG + Intronic
1132387466 15:101410573-101410595 GAGGCCAAAATATGCTTGGAAGG + Intronic
1135904996 16:26503564-26503586 GAGGAACAAAGAGCCTTGGATGG - Intergenic
1137240471 16:46651419-46651441 GAGGCCAAACTAACTTTGGAAGG - Intergenic
1138510949 16:57508172-57508194 CTGGACAAAATGGCCTTGGCTGG + Intergenic
1140603090 16:76501516-76501538 CAGGGCAAGATTGCCTTGGATGG - Intronic
1146443234 17:32915358-32915380 AAGGAAGAAATAGCCTTGGAAGG - Intergenic
1146686070 17:34842346-34842368 GAGAACAAAAGAGCCCTGCAGGG + Intergenic
1148321656 17:46759425-46759447 GAAGACAAAATATCCAAGGAGGG + Intergenic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1153486468 18:5603723-5603745 AAGGAAAAAATAGCCTGGCATGG + Intronic
1155616937 18:27733104-27733126 GAGGCCAAAATAAAATTGGAAGG + Intergenic
1156620673 18:38847715-38847737 GAGGACAAAATATCCTTCAAAGG - Intergenic
1156633951 18:39004792-39004814 GAGGACAAACAAGGCTTGTATGG + Intergenic
1156933097 18:42669036-42669058 GAAAACAAAATAGCCTTGTAAGG - Intergenic
1162523617 19:11195401-11195423 GGGGACAAAAGAGCCCTGGCCGG - Intronic
1164155265 19:22591972-22591994 GAAGACAAATTTTCCTTGGATGG + Intergenic
925605436 2:5655284-5655306 GAGAAAAAAATAGCTCTGGAGGG + Intergenic
925691281 2:6525825-6525847 AAAGACAAAATTGCCTTGGAAGG - Intergenic
926536892 2:14124187-14124209 GAGGAAAAAAAAGCCTTCAAAGG - Intergenic
926850946 2:17196473-17196495 GAGGAAAAGATAGCTTTGCATGG - Intergenic
928767813 2:34669372-34669394 AAGGACAAAATAGCATTGACTGG + Intergenic
930116411 2:47722122-47722144 GATGACAACCTAGCGTTGGAAGG + Intronic
930120734 2:47758547-47758569 AAGGATAAAATAACCTGGGAAGG + Intronic
930573032 2:53110831-53110853 GAGGACACAATGGCCCTGGAGGG + Intergenic
931678140 2:64718399-64718421 GAAGACAAAATAGACTTGACAGG + Intronic
934724800 2:96609081-96609103 GAGGACTAAAAGGCCTTGGTTGG - Intronic
935046056 2:99483786-99483808 GGGGAAAAAATGGCCTTGGGGGG + Intronic
936906753 2:117545087-117545109 GATGACAAAATATTCTTGCAAGG + Intergenic
937633812 2:124133274-124133296 AAGGACCAAAGGGCCTTGGAAGG - Intronic
938017704 2:127881405-127881427 GTGGACTTAGTAGCCTTGGAAGG - Intronic
940819546 2:158336938-158336960 GAGGATAAAATAGCTTAGGAAGG - Intronic
942058737 2:172208345-172208367 GAGGACAAATTAGTATAGGAGGG + Intergenic
942475556 2:176316172-176316194 GTGGACCAAATAGCCTTTGTAGG + Intronic
942625929 2:177900845-177900867 GAGGACCAAATATCCTGGGTAGG + Intronic
945244678 2:207707251-207707273 GAGGAGAAAAGAGCCCAGGAAGG + Intergenic
945337029 2:208604364-208604386 GAAGACTAAAGAGTCTTGGAGGG - Intronic
1168946069 20:1759085-1759107 GATGACATAATAGCCTTTGTAGG + Intergenic
1169964826 20:11205131-11205153 GAGGACTTAAAAGCATTGGAAGG + Intergenic
1171971432 20:31567334-31567356 GAGGGCACAATAGCATTGGGTGG - Intronic
1177286343 21:19056399-19056421 GTGGACAAAACAGCCTTCTATGG + Intergenic
1180882381 22:19214951-19214973 TAGGTAAAAATAGCCTTGGCTGG - Intronic
1181321019 22:22006234-22006256 AAGGGCAAAATAACATTGGAAGG + Intergenic
1181439609 22:22928992-22929014 GAGCCCAGAATAGCCTGGGAGGG + Intergenic
1183484173 22:38080643-38080665 GAGGACAGAAAAGCCCAGGAAGG - Intronic
1183569115 22:38639050-38639072 GATGAGGAAACAGCCTTGGAGGG - Intronic
949559844 3:5190756-5190778 GAGGCCAAAGAAGCCTTGCATGG + Intronic
952697584 3:36287037-36287059 GAGGACAATAGAGGCTGGGAAGG + Intergenic
962385140 3:134926903-134926925 GAGGACAAATTGGCAATGGATGG + Intronic
962436444 3:135371471-135371493 GTGGACAAACTAGCCTTGTTTGG - Intergenic
963317121 3:143771763-143771785 GAGGAGAAAAGAGCCTGGGAGGG - Intronic
965453331 3:168866294-168866316 AAGGAAAAAACAGGCTTGGAAGG - Intergenic
978948412 4:114526685-114526707 TAGGTCAAAATAGCCTTTGATGG - Intergenic
979024988 4:115559066-115559088 GAGATGAAAATAGACTTGGAGGG + Intergenic
979722349 4:123916166-123916188 TAGAACATAATAGCCTTGGTTGG + Intergenic
979734301 4:124063565-124063587 TGGGAAAACATAGCCTTGGAAGG + Intergenic
979833789 4:125335099-125335121 TAGGACAAGACAGCTTTGGATGG + Intronic
980051534 4:128044784-128044806 GAGGAAAAAATGCCCTTGTAGGG - Intergenic
981152355 4:141394045-141394067 GAGGATAAAATAGCCATCCAAGG - Intergenic
983021983 4:162688575-162688597 GAGGAAAAAATATCATTCGATGG - Intergenic
985989070 5:3540130-3540152 GAGGACAAAGTACCCTTAGGTGG + Intergenic
986449726 5:7852021-7852043 GAGGACCAAGTTGGCTTGGAAGG - Intronic
989794843 5:45455168-45455190 GAAGAGAAAATAGGCTTGCATGG + Intronic
991478190 5:67046194-67046216 GAGGACAAAATAGCCTAACGAGG + Intronic
994748395 5:103707742-103707764 GAGGACAAAATAAACTCAGATGG + Intergenic
998329225 5:141309129-141309151 GAGGCAAAAATAGCCTAGCATGG - Intergenic
998413810 5:141930655-141930677 AAGGAAAAAATAATCTTGGAGGG + Intronic
999280526 5:150362398-150362420 GAGTACTGAATTGCCTTGGATGG + Intronic
1001573543 5:172746882-172746904 GAGGACAAACATGCCTTGGTTGG - Intergenic
1002109566 5:176899214-176899236 GAGGACAAGACAGCTGTGGAAGG + Intronic
1002314268 5:178333281-178333303 CAGGCCAAAAAAGCCCTGGAAGG + Intronic
1003795367 6:9596750-9596772 CAGCACAAAATACCCTGGGAAGG - Intronic
1008826071 6:55695965-55695987 GAGGAGAAAAGAGCATTTGAGGG - Intergenic
1009328688 6:62386940-62386962 GAGCACAAAATAACATTGTATGG - Intergenic
1011359225 6:86504295-86504317 GAGTACAAAATATAGTTGGATGG - Intergenic
1013158711 6:107520834-107520856 GAGAACAAAGTTGCCTTAGAGGG - Intronic
1014136151 6:117892353-117892375 GGTGATAAATTAGCCTTGGAGGG + Intergenic
1014236849 6:118967547-118967569 CAGGACAGAATAGGCTTAGAAGG - Intronic
1014590646 6:123263516-123263538 GTAGACAAAATAGCCTTCTAGGG + Intronic
1020222390 7:6249696-6249718 GGGGAAAAAAGAGCCTGGGAAGG - Intronic
1020582165 7:10016832-10016854 GGGAAGAAAATAACCTTGGAAGG + Intergenic
1021767258 7:23962399-23962421 GAGCACAAAATGACCTTGCAAGG + Intergenic
1021788489 7:24176221-24176243 GGGGACAAAATGCCCATGGATGG + Intergenic
1022389130 7:29928197-29928219 GAGGACAAAATTGGCTGGCAAGG - Intronic
1023190644 7:37577502-37577524 GAGGACAAAACAGCTGAGGACGG - Intergenic
1024456903 7:49618796-49618818 AAGGACAAAATAACTTTGAAAGG + Intergenic
1028128165 7:87138876-87138898 GAGAACAAAATTTCCTTGGCAGG + Intergenic
1029698428 7:102229915-102229937 AATGACAAAATAGGCTTGGCTGG - Intronic
1030408596 7:109145989-109146011 TTGGACAAAATTCCCTTGGAGGG + Intergenic
1034399474 7:150852605-150852627 GAGGACAGAAAAGCAGTGGAAGG + Intronic
1036505238 8:9348817-9348839 GGGGAGAAATAAGCCTTGGAGGG - Intergenic
1040532395 8:48276399-48276421 CAGGACAACATAGCCATAGAGGG - Intergenic
1041730493 8:61057415-61057437 GAGGCCAAATTTTCCTTGGATGG - Intronic
1042145950 8:65730554-65730576 GAAGACAATATTTCCTTGGATGG - Intronic
1042551393 8:69996870-69996892 GAGGACAACATAGCTAAGGAGGG - Intergenic
1045424359 8:102049201-102049223 GAGGAAAAAATAGTCTTTAAGGG + Intronic
1046906946 8:119583530-119583552 GAAGACAAAGAAGCCTTAGAAGG + Intronic
1047931312 8:129731208-129731230 AAGGAAAGAATATCCTTGGAAGG + Intergenic
1048619017 8:136110826-136110848 CATGACAAAATAGCATAGGATGG - Intergenic
1050756667 9:9012632-9012654 GAGAACAAAACAGACTTTGAAGG + Intronic
1050941930 9:11471456-11471478 GGGGACAAACAAGCATTGGAGGG + Intergenic
1054850876 9:69845566-69845588 GAGGACAAATTAGCTTAGCATGG + Intronic
1057393334 9:94657501-94657523 GGTGACAAAGTAGCCTTGGGTGG - Intergenic
1059930589 9:119256468-119256490 TACGAAAAAATAGACTTGGATGG - Intronic
1060692169 9:125672594-125672616 GAGGAGAAAATAGCCTTTTAAGG - Exonic
1060983253 9:127805691-127805713 AAGGAGAAAATTGCCTTGCAAGG + Intronic
1188478129 X:30608681-30608703 GAGGACAAAATAGCTGTGTTTGG - Intergenic
1189979209 X:46492194-46492216 GGGGATAAAATAGCCCTCGAAGG + Intronic
1191753643 X:64570670-64570692 GAAGACAGGATAGCCATGGAAGG + Intergenic
1192306759 X:69968502-69968524 GAGGCCAAAATAGCCTAAGGGGG + Intronic
1196221398 X:113115231-113115253 GAGGACAAAATAAACTAAGATGG - Intergenic
1196342809 X:114615687-114615709 AAGGACAGAATAGCATTGAAAGG - Intronic
1199661564 X:150055426-150055448 GAGGAAAAAAAAGACTTGGCTGG - Intergenic
1202628679 Y:56886348-56886370 GAGGAAAAAACAGGGTTGGAAGG - Intergenic