ID: 917594433

View in Genome Browser
Species Human (GRCh38)
Location 1:176514735-176514757
Sequence TTGACTTTGAATCAAATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 407}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917594431_917594433 18 Left 917594431 1:176514694-176514716 CCATAGCATTCTTCATGGGATGA 0: 1
1: 0
2: 0
3: 10
4: 116
Right 917594433 1:176514735-176514757 TTGACTTTGAATCAAATTTTAGG 0: 1
1: 0
2: 2
3: 35
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917594433 Original CRISPR TTGACTTTGAATCAAATTTT AGG Intronic
901269091 1:7936770-7936792 TTGACTAAGAATAAAAATTTGGG - Intronic
902318528 1:15642611-15642633 TTGTTTTTATATCAAATTTTGGG - Intronic
904045532 1:27606108-27606130 CTCAGTTTGAATCAAGTTTTAGG + Intergenic
908019804 1:59887894-59887916 TTGCCTCTGAATCAAATTTCAGG - Intergenic
908441563 1:64160174-64160196 ATCACTTTTAATAAAATTTTAGG + Intronic
908537142 1:65089104-65089126 TGGAATTTGACTCAAACTTTGGG + Intergenic
909166266 1:72229381-72229403 TTGATTTTAAATGATATTTTAGG + Intronic
909252201 1:73372669-73372691 TATATTTTGAATCAAAATTTGGG + Intergenic
909955563 1:81774448-81774470 TTGACTGTGCATCAGAATTTTGG + Intronic
910101580 1:83583429-83583451 CTGACTTTGAAGCAAAGTTGAGG - Intergenic
910437898 1:87224248-87224270 GTGACTTTGAATCAGTTCTTTGG - Intergenic
911545155 1:99207690-99207712 TTGAATGTAAATCTAATTTTTGG - Intergenic
911898341 1:103468208-103468230 ATGTCTTTGTATCACATTTTAGG - Intergenic
912655052 1:111478480-111478502 TTGACTTTATTTGAAATTTTTGG - Exonic
913315168 1:117543883-117543905 TTGAATTTGTTTCAAATATTTGG + Intergenic
915763014 1:158334516-158334538 TTTAATTTGAAACAAATATTGGG - Intergenic
915799910 1:158779503-158779525 TTGAGTTTGAAAGAAATGTTCGG - Intergenic
916154056 1:161826855-161826877 TTGTCCCTGAATCAAATGTTGGG + Intronic
916860833 1:168803214-168803236 TTGACTTTTAAAAAATTTTTAGG - Intergenic
917048932 1:170895967-170895989 GTGACTATGATTCATATTTTAGG + Intergenic
917223898 1:172761427-172761449 TTAAATTTTAATGAAATTTTAGG - Intergenic
917594433 1:176514735-176514757 TTGACTTTGAATCAAATTTTAGG + Intronic
918001273 1:180499673-180499695 TTTACTGAGAATCATATTTTAGG - Intronic
918429256 1:184441405-184441427 ATGACTGTGAATCAAGATTTGGG - Intronic
918870849 1:189972384-189972406 TCGACTTGGATTCACATTTTAGG - Intergenic
919364110 1:196635090-196635112 TTAAATTTGAATAAAATATTAGG - Intergenic
921541723 1:216424391-216424413 TTTAATTTAAAACAAATTTTAGG + Intergenic
923291218 1:232548014-232548036 AAGACTGTGAATCACATTTTGGG - Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1063199938 10:3778533-3778555 CTGAATTTGAATTAACTTTTTGG - Exonic
1063742668 10:8840723-8840745 TTGACTTTGAAATAAGTTCTAGG - Intergenic
1063798857 10:9547406-9547428 TTAACTTAAAATCAAATTATTGG + Intergenic
1064169971 10:13022371-13022393 TTCACCCTGAATCAAAATTTTGG - Intronic
1064934153 10:20661597-20661619 TTGGCTCTGAATAAAATTATGGG - Intergenic
1065560716 10:26961361-26961383 TTGCCTTTGATTCAAAGTTGGGG - Intergenic
1066073257 10:31844057-31844079 TTCATTTTGAATTTAATTTTTGG - Intronic
1067173890 10:43929065-43929087 GTGATTTTGAATCAAATAGTGGG + Intergenic
1068771625 10:60828037-60828059 TTGACCTTGAGTCAAATGTCTGG + Intergenic
1068816376 10:61319571-61319593 GTGACTGTGACTCAAATATTAGG + Intergenic
1068942995 10:62699072-62699094 TTGTCTTTCAATCATATTTGTGG - Intergenic
1069325053 10:67223363-67223385 TTGACTTTATGTAAAATTTTAGG - Intronic
1070459953 10:76655548-76655570 TTAACTTTGAAACTCATTTTTGG - Intergenic
1071078387 10:81781761-81781783 TATACTTTGAATCTTATTTTTGG - Intergenic
1071179015 10:82961319-82961341 TTGAATTTAAACCACATTTTGGG - Intronic
1071218795 10:83439166-83439188 TTTAATTTCAAGCAAATTTTTGG + Intergenic
1071921755 10:90358220-90358242 ATTACTTTGAATCAAATTGTTGG + Intergenic
1073755151 10:106573276-106573298 CTAACTTTAAATCAAATATTTGG + Intergenic
1074012549 10:109497458-109497480 GTGACTTTGAATTATATTTTTGG - Intergenic
1075231437 10:120682828-120682850 TTAACTTTTAAGCTAATTTTAGG + Intergenic
1075932944 10:126314486-126314508 TTGAATTTGGGACAAATTTTGGG + Intronic
1076264139 10:129095985-129096007 TTGAATTTGATTAAAATTGTAGG - Intergenic
1078274058 11:9825675-9825697 TTGATTCTGAACCAAATTCTAGG + Intronic
1078614206 11:12849909-12849931 TTTACTTGGAAACAATTTTTAGG + Intronic
1078786669 11:14500823-14500845 TGGCCTTTGAATACAATTTTGGG - Intergenic
1079892337 11:26071771-26071793 CTGACTTTGTATCAATTTTCAGG + Intergenic
1080332837 11:31160027-31160049 TTTACTTTCCATAAAATTTTAGG + Intronic
1080617284 11:33955707-33955729 CTGAATATGAATCAAATCTTTGG + Intergenic
1085439978 11:76551796-76551818 TAGACTTTGCATACAATTTTAGG + Exonic
1085987379 11:81802864-81802886 ATGACTTTGAATAGAATTTGAGG + Intergenic
1087011126 11:93515089-93515111 TTGAGTTTTAATTATATTTTGGG - Intronic
1087645747 11:100806524-100806546 TTTAATTAGAAACAAATTTTAGG + Intronic
1088330603 11:108647325-108647347 TTGACTTTTTAACAAACTTTTGG - Intergenic
1088614105 11:111605615-111605637 TTGACTCTGAGGCAAATTTTAGG + Intronic
1089381538 11:118036210-118036232 TGGACTGTGAATCAATTTTATGG - Intergenic
1089493197 11:118896221-118896243 TTTATTTTGAAACAATTTTTAGG - Exonic
1090146298 11:124326770-124326792 TTAACTTTAAATAAAATCTTTGG + Intergenic
1092800738 12:12163605-12163627 TTTACTTTAAACAAAATTTTAGG - Intronic
1093774911 12:23062398-23062420 TTGACTTTGAAACTGATTTTGGG - Intergenic
1093836403 12:23835025-23835047 TTGATTTTCATTCAAACTTTAGG - Intronic
1094076569 12:26482552-26482574 TTAACTTTAAATCAACATTTAGG + Intronic
1094247655 12:28319314-28319336 TGGACTTTTAATCCATTTTTTGG - Intronic
1095324187 12:40867978-40868000 TTAGCTTTGAACCTAATTTTGGG + Intronic
1099165438 12:79301089-79301111 TTGACTTTGTGTAAATTTTTTGG + Intronic
1099240238 12:80129732-80129754 GTGACTATGAATAAAATTTCAGG - Intergenic
1099334050 12:81330567-81330589 GTGATTTTGAATGAAATTTAAGG - Intronic
1099354315 12:81614665-81614687 TTGTCTTTAAATAAAATTCTTGG - Intronic
1099381942 12:81965366-81965388 TCGACTTTGAATTAATTTTGGGG + Intergenic
1099535629 12:83840806-83840828 TTAACTATAAATCAAATTTTAGG + Intergenic
1099723162 12:86390651-86390673 TTGTTTGTGATTCAAATTTTGGG - Intronic
1099921768 12:88967012-88967034 TTGACCTTGAATCTGATATTAGG + Intergenic
1104580567 12:130008212-130008234 TAGACTTTGAATCAACCATTTGG - Intergenic
1104659943 12:130604366-130604388 ATGCCTTTGAATCATGTTTTAGG + Intronic
1105430516 13:20333312-20333334 TTAACTTGGATTCAAATTCTGGG + Intergenic
1105712723 13:23028616-23028638 TCGAATTTGAACCTAATTTTAGG - Intergenic
1106443316 13:29800482-29800504 TTTACATTGAATCAATTTCTAGG - Intronic
1108006852 13:45956740-45956762 TTGTTTTTGAATAAAATTGTTGG + Intronic
1108041866 13:46346710-46346732 TTGCTTTTTAATTAAATTTTGGG - Intronic
1108955453 13:56151232-56151254 TTAATTTTGAAATAAATTTTAGG - Intergenic
1108964789 13:56284515-56284537 TTCATTTTGAAATAAATTTTAGG + Intergenic
1109300976 13:60589917-60589939 GTGACTTTGAATCAAATGGGAGG - Intergenic
1109451247 13:62517781-62517803 TTGGCTTTCAATGAAAGTTTTGG - Intergenic
1109452012 13:62528286-62528308 TTGACTCTAAATCACAATTTTGG - Intergenic
1109966940 13:69712639-69712661 TTCACTTTTATTTAAATTTTAGG + Intronic
1110588729 13:77228163-77228185 TTGAATTTGGACTAAATTTTTGG - Intronic
1112209059 13:97355713-97355735 TTAACTTTGAACCATAATTTTGG - Intronic
1112795998 13:103057447-103057469 TTGCCATTAAATCAACTTTTGGG + Intronic
1115082551 14:29474393-29474415 CTGACTTTGAATCAACCCTTTGG - Intergenic
1116114236 14:40627981-40628003 TTCACTTTGACTGACATTTTTGG + Intergenic
1116548303 14:46199859-46199881 TTGGCTTTTAATTAAATTATGGG + Intergenic
1117802768 14:59462824-59462846 TTGACTTCAAATTACATTTTTGG + Exonic
1118410750 14:65475286-65475308 TTTATTTTCAATCACATTTTGGG - Intronic
1118522658 14:66603434-66603456 ATGACTTTGAACTAAATTTTTGG - Intronic
1118603920 14:67489251-67489273 TGGGATTTGAATCAAATGTTTGG - Intronic
1120053191 14:79892270-79892292 ATGACTTTGAATAGAATGTTAGG + Intergenic
1120649121 14:87109867-87109889 TTGATTTTGAATGACATTTCAGG - Intergenic
1120694730 14:87631971-87631993 TTGGCTTTGAAGCAAATGTTAGG - Intergenic
1120747105 14:88162360-88162382 TTGAGTTTGAATCATGATTTTGG + Intergenic
1124343546 15:28905333-28905355 TGGACTTTGAAGCAAGCTTTCGG + Intronic
1124463240 15:29912336-29912358 TTAGTTTTGAATCAAATATTAGG + Intronic
1124820614 15:33042862-33042884 ATGACATGGAATCAAATTTTAGG - Intronic
1124875280 15:33586215-33586237 TTGACTTTGATAAAAATCTTGGG + Intronic
1126347754 15:47715082-47715104 TTGACATTTAAACAAATTGTTGG + Intronic
1126494195 15:49272136-49272158 CTGGCTTTGAATCTTATTTTAGG + Intronic
1126848170 15:52781029-52781051 TTGCCTGTAACTCAAATTTTAGG - Intronic
1128422864 15:67511108-67511130 TTTTGTTTGAATAAAATTTTAGG + Intergenic
1128962932 15:72027236-72027258 TTGACTTCCATTCAAATATTGGG - Intronic
1128997304 15:72306507-72306529 TTTCCTTTGGATCAAATTTGGGG + Intronic
1129234952 15:74218376-74218398 TTGGCTTTGACTCAAAGTCTGGG + Intergenic
1130190229 15:81727592-81727614 TTGACTTTGCATCAAAGTCAAGG + Intergenic
1130798907 15:87240441-87240463 GTGACTCTGAATTAAATTTATGG + Intergenic
1131234777 15:90686038-90686060 TTTATTTTTAATCAAGTTTTTGG - Intergenic
1132125633 15:99221666-99221688 TTAAGTGTGAATCAAATTTTGGG + Intronic
1132166195 15:99593546-99593568 TTCACTTGTAATCAAAATTTAGG - Intronic
1133152051 16:3841314-3841336 GTGACTTTGCTTCAAATTCTCGG - Intronic
1134332234 16:13261565-13261587 TTGACTAGGAATAAAATTTGGGG + Intergenic
1137948601 16:52760133-52760155 CTGACTTTTAAGCAATTTTTAGG + Intergenic
1139045139 16:63048533-63048555 TTGACTTTGGATCTGCTTTTAGG + Intergenic
1139080372 16:63511108-63511130 TTTACTTTGAATCTACTGTTTGG + Intergenic
1140492744 16:75353408-75353430 ATGATTTTGAAGCAAATTTCAGG - Intronic
1140595821 16:76409556-76409578 TTGCCTTTGCATATAATTTTTGG - Intronic
1140864144 16:79045085-79045107 TAGATTTTGCCTCAAATTTTAGG + Intronic
1141143343 16:81512204-81512226 TTGATTTGGATTAAAATTTTCGG + Intronic
1144601100 17:16614708-16614730 TTGACTTTGTATCAGAATTATGG - Intergenic
1144661674 17:17074761-17074783 TTGACTTAGCATCATGTTTTCGG + Intronic
1146029118 17:29349303-29349325 TTAAATTTGAATCTAAGTTTGGG - Intergenic
1146417556 17:32650429-32650451 TTAACATTTCATCAAATTTTGGG + Intronic
1146496719 17:33329254-33329276 TTCACTTTGAAGGATATTTTAGG + Intronic
1149199684 17:54168698-54168720 TTTACTTTGCATCAAAATCTAGG - Intergenic
1151584189 17:74998664-74998686 GTGACTTTGAATCAAGTGATTGG + Intronic
1152494808 17:80663509-80663531 TTGTCTTTGAATGAATTATTAGG + Intronic
1156353211 18:36319173-36319195 TTGACTCTTTATCCAATTTTAGG - Intronic
1156578388 18:38346598-38346620 TTTACTTTTAAAAAAATTTTAGG - Intergenic
1157378266 18:47186255-47186277 TTGACTTTAAAAGAAATATTCGG - Intergenic
1158285159 18:55872716-55872738 TTGTTTTTGAATAATATTTTAGG + Intergenic
1159046656 18:63375328-63375350 TTGACTTTTTGTCAACTTTTTGG - Intergenic
1159538525 18:69745979-69746001 GTGATTTAAAATCAAATTTTGGG - Intronic
1164749738 19:30643910-30643932 TTCAATTTGAATCAAAAATTGGG + Intronic
1165717287 19:38054611-38054633 TTGTCTTTGAATCCAAGTTTAGG + Intronic
1166182400 19:41118147-41118169 TTGTCTTTGAAATAAAGTTTGGG - Intronic
1167385461 19:49160571-49160593 TTGAATATGAATCAAAGTTCAGG + Intronic
925929000 2:8692833-8692855 TTGACTGGGAAGGAAATTTTTGG + Intergenic
926227808 2:10980906-10980928 TTGACTTTGAACCAAATCTCAGG + Intergenic
927466653 2:23341749-23341771 TAGACTCTGAATCACATTTGAGG + Intergenic
928713610 2:34035081-34035103 ATGACTATGAATCAAATGTGGGG - Intergenic
930574713 2:53132320-53132342 TTGTTTTTGAATTAAATTTTTGG - Intergenic
930679990 2:54247056-54247078 TTGTCTTCTAATCTAATTTTAGG - Intronic
931344964 2:61437960-61437982 TTAACTTTGCTTCAATTTTTTGG - Intronic
931536500 2:63283091-63283113 CTGACTGTGTATCAAATTTGTGG + Intronic
932966058 2:76475746-76475768 TTTACTTTTGATGAAATTTTTGG - Intergenic
933016516 2:77135042-77135064 TTGACTCTGAATAAAATTATAGG + Intronic
933437545 2:82267770-82267792 TTGACGTGGAGTCAAATTTTTGG - Intergenic
934332121 2:92078411-92078433 TAGACTATGAAACAAATATTTGG - Intergenic
934621362 2:95810445-95810467 CTGACTTAGAAACAAAATTTTGG - Intergenic
934812079 2:97288369-97288391 CTGACTTAGAAACAAAATTTTGG + Intergenic
934825614 2:97419558-97419580 CTGACTTAGAAACAAAATTTTGG - Intergenic
936149559 2:110007633-110007655 TTGACTGTATATGAAATTTTTGG + Intergenic
936195119 2:110363736-110363758 TTGACTGTATATGAAATTTTTGG - Intergenic
936842021 2:116781096-116781118 AAGACTGTGAACCAAATTTTGGG - Intergenic
936888603 2:117342329-117342351 CAGACTTGGATTCAAATTTTGGG + Intergenic
937270932 2:120651985-120652007 TTGACATTGAAGCCAAATTTGGG - Intergenic
940249873 2:151663554-151663576 TTGAATCTGCATCATATTTTTGG + Exonic
941306245 2:163871539-163871561 TTGGTTTTGAATAAAATATTAGG + Intergenic
941420594 2:165279140-165279162 TGGGTTTTGAATCAAATTATTGG - Intronic
941432496 2:165428227-165428249 TTGTCTTGGAAACAAAATTTGGG - Intergenic
941548739 2:166888176-166888198 ATGACTTTGAATTAAATATTAGG + Intergenic
942900421 2:181110287-181110309 TTGACTTTCACTGTAATTTTAGG - Intergenic
943321521 2:186449594-186449616 TTGATTTACAAACAAATTTTGGG + Intergenic
944004128 2:194881480-194881502 TTGTCTTTGATTCATCTTTTTGG - Intergenic
944514383 2:200497042-200497064 TTATCTTTGGATCCAATTTTAGG + Intronic
944693010 2:202174716-202174738 GTTATTTTGAAACAAATTTTAGG + Intronic
945258354 2:207821197-207821219 TTGACTTTGAATTAATATATAGG + Intergenic
945458504 2:210077007-210077029 TTGTTTTTGAATCATATTTATGG + Intronic
946920145 2:224571857-224571879 TTGTCTTTTACTGAAATTTTTGG + Intronic
946995862 2:225390340-225390362 TTGACTATAAATTAAATTTAAGG - Intergenic
947321021 2:228919167-228919189 TAAACGTTGCATCAAATTTTTGG - Intronic
947395404 2:229681760-229681782 CTGAATTTGAATGAGATTTTGGG - Intronic
947561291 2:231154818-231154840 TTGACATTGAATCATTTTTGAGG + Intronic
1169307711 20:4507453-4507475 TTGACTTTGAATCAGATGGAGGG + Intergenic
1169634375 20:7671717-7671739 ATGACTTTGAATAACACTTTTGG + Intergenic
1170432949 20:16293973-16293995 TTGACTTTTTAAAAAATTTTAGG - Intronic
1171430301 20:25079110-25079132 TTTCGTTTGAATCAAATTTCTGG - Intronic
1172221036 20:33275327-33275349 TTGACTTTGGAACACAGTTTTGG - Intronic
1175016981 20:55802065-55802087 TGGACTTTGATTCAAATTCAGGG - Intergenic
1176698507 21:10011513-10011535 TCAAGTTTGAATCAAATATTAGG + Intergenic
1177535109 21:22415655-22415677 TTGACTTTGAGCAAAATTTCAGG - Intergenic
1177975554 21:27845385-27845407 TAGACTATGAAACAAATATTTGG - Intergenic
1178139163 21:29662593-29662615 GTGACTTTCAAGCAAATTTGAGG - Intronic
1178871028 21:36375995-36376017 TTTACTTTGAAGCCCATTTTTGG + Exonic
1182089256 22:27583076-27583098 TTTCCTTTGAATAAAATCTTAGG - Intergenic
1182759406 22:32710031-32710053 TTGACTTAGAAACACTTTTTTGG - Intronic
1183816941 22:40310035-40310057 TGCACTTTGAATAAAATTTTAGG - Intronic
949282861 3:2366797-2366819 TGGACTTTGAATCCAAGGTTTGG - Intronic
949363301 3:3254386-3254408 TTGATTTTCAAACCAATTTTAGG - Intergenic
949810993 3:8005900-8005922 TTCTCTTTAAATGAAATTTTTGG - Intergenic
950092821 3:10308722-10308744 TAGACTTTAAAGAAAATTTTGGG - Intronic
951099480 3:18670251-18670273 TAGACCTTGAAGCAAAATTTTGG + Intergenic
951538187 3:23758654-23758676 TTGAATTTGAATGATAATTTTGG - Intergenic
952045634 3:29315763-29315785 ATGTCCATGAATCAAATTTTAGG + Intronic
952090287 3:29877160-29877182 TTGACTTTGAGACAAACATTTGG + Intronic
952469934 3:33636899-33636921 TTGTCTTTAAACAAAATTTTTGG - Intronic
955647218 3:61152833-61152855 TTGTCTTTGAATTAAACATTTGG - Intronic
957366618 3:79232730-79232752 TTGGCTCTGTATCAAATTCTAGG - Intronic
957411309 3:79844611-79844633 TTGATATTTAATCACATTTTTGG + Intergenic
957651400 3:83010139-83010161 TTGACTTGCAATCAAAGTTTTGG - Intergenic
957706787 3:83797971-83797993 TTGTCTTTGAAGCAAATATAGGG + Intergenic
957749402 3:84392971-84392993 TTGATAATGAATCAAAATTTAGG - Intergenic
958588001 3:96116710-96116732 TTGAATTAAAATCAAATATTAGG + Intergenic
958713773 3:97752698-97752720 TTAACTTGAAATCAAGTTTTTGG + Intergenic
958744956 3:98122696-98122718 TTGGGTTCAAATCAAATTTTAGG - Intergenic
958891232 3:99785449-99785471 TTGACTTTGTATTAAACTTTAGG + Intronic
959364897 3:105444600-105444622 TCATCTTTGAAACAAATTTTAGG - Intronic
959770737 3:110092115-110092137 TAAAATTTGTATCAAATTTTTGG - Intergenic
960058333 3:113292958-113292980 GTGACTTTGAAGGAAACTTTAGG + Intronic
960083209 3:113563428-113563450 TTGACTATGACTCAAAATTCAGG + Intronic
960243693 3:115375694-115375716 TGGACTTAGAAACAAATTTCTGG + Intergenic
960451138 3:117809527-117809549 TTGACATTGAATGAAAGTCTTGG - Intergenic
960483257 3:118219364-118219386 TAGACTTGGAATCAAATATGAGG - Intergenic
960916859 3:122703706-122703728 TAAAATTTGAAACAAATTTTTGG + Intronic
961158588 3:124702353-124702375 TGTACTTTGAAGAAAATTTTGGG - Intronic
961250144 3:125495701-125495723 TTGTCTTTGAATACAGTTTTTGG - Intronic
962083900 3:132170369-132170391 TGGGCTTTGAATCATATTTCTGG + Intronic
962723022 3:138193951-138193973 TTGTCTTTGAATCACTTTGTAGG + Intronic
963993013 3:151674998-151675020 TAAAGTTTGAATCAAATTATAGG + Intergenic
964050010 3:152379436-152379458 TTGACTATGAGTTATATTTTTGG + Intronic
964760913 3:160134267-160134289 TTGACTGTGACTCTCATTTTTGG + Intergenic
965012319 3:163109498-163109520 TTGTCTTTGAAGGAAAATTTTGG + Intergenic
966954992 3:184867327-184867349 TTGACTTAGAATAGAATTGTTGG + Intronic
969887129 4:10224921-10224943 TTGACTTTGGAGGAAATATTGGG + Intergenic
969978883 4:11133607-11133629 TTGACTCTGAATCAATTGCTAGG - Intergenic
970075681 4:12216948-12216970 GTGCCTCTGAATGAAATTTTGGG + Intergenic
971099013 4:23441807-23441829 TTGACTTTGAGTCATATATAAGG - Intergenic
971683875 4:29738872-29738894 TTGCATTTGCATCATATTTTTGG + Intergenic
972078496 4:35117662-35117684 TTGCCTTTAAACCACATTTTGGG - Intergenic
972172869 4:36368085-36368107 TTGACTTTTAGTCAAAGCTTTGG + Intergenic
972550453 4:40128042-40128064 TTCACTTTGAATTTTATTTTTGG + Intronic
973884956 4:55311602-55311624 TTGAATTTGCATCAAGTTTGGGG - Intergenic
974066509 4:57082497-57082519 TTAAATTTGAATCAAGTTTTTGG + Intronic
974120433 4:57631798-57631820 TTGACTTTGAATCAAATTCAGGG - Intergenic
975567487 4:75774181-75774203 TTGACTTAGAATCAAGTTTTGGG + Intronic
976558147 4:86473389-86473411 TCTATTTTGAATGAAATTTTTGG - Intronic
976639797 4:87326351-87326373 TTGTCTTTCACTCACATTTTAGG + Intergenic
976762270 4:88562326-88562348 CTCACTTTTAATCAAATTATTGG + Intronic
976796832 4:88943186-88943208 TTAATTTTGAATTCAATTTTGGG - Intronic
976814931 4:89137456-89137478 TTGAATTTGAATAAAATTTACGG - Intergenic
977003188 4:91529403-91529425 TTGTTTTTCAATCATATTTTGGG + Intronic
977190094 4:93988754-93988776 TTGACTTTTACTTATATTTTAGG + Intergenic
977799775 4:101213142-101213164 ATGACTTTGATTAAAATTTCTGG - Intronic
978019961 4:103796105-103796127 ATGACTTTGAATTTTATTTTAGG + Intergenic
978333316 4:107639299-107639321 TTTACTTTGAAAGTAATTTTGGG - Intronic
978334479 4:107651134-107651156 CTGATTTTGAAGCAAATATTTGG - Intronic
978962815 4:114704409-114704431 TAAACTTAGAATCAAATTTATGG + Intergenic
978978290 4:114908627-114908649 TTGAGTTTTAAACAATTTTTTGG + Intronic
978978424 4:114910705-114910727 CTGATTTTGAAATAAATTTTAGG - Intronic
979063049 4:116091126-116091148 TTGACATTCAATAAAATTTTAGG + Intergenic
979150007 4:117299754-117299776 TTGACATGGCCTCAAATTTTTGG + Intergenic
979569963 4:122210083-122210105 TTTACTTTGTGTCAAATGTTGGG + Intronic
980344169 4:131590868-131590890 TTGACTTTGACTGAAATTAGAGG + Intergenic
980370998 4:131870998-131871020 TCAAGTTTGAATCAAATATTAGG + Intergenic
980515830 4:133859080-133859102 TTGGTTTTGAATCACAATTTTGG + Intergenic
980746412 4:137022598-137022620 TTGACTTTTACACAAATTGTAGG - Intergenic
981206284 4:142044494-142044516 GTGACTTTCAGTCGAATTTTAGG + Intronic
981822876 4:148905885-148905907 TTGGCATTGAATTATATTTTGGG + Intergenic
981964778 4:150586774-150586796 TTTAAATTAAATCAAATTTTAGG + Intronic
982529606 4:156522601-156522623 TTGACTATGAGCAAAATTTTAGG + Intergenic
982855833 4:160381670-160381692 TTGACTTTATATCAACTATTTGG + Intergenic
983005931 4:162485093-162485115 TTGCCTTTGAATCAGTTTTTGGG + Intergenic
983197275 4:164821164-164821186 TTGACTACATATCAAATTTTTGG - Intergenic
983268969 4:165538898-165538920 GTGACTTTGACTAAAATTCTAGG - Intergenic
983347968 4:166551146-166551168 TTGACTTTGCATTCTATTTTTGG + Intergenic
983448552 4:167882055-167882077 TGCATTTGGAATCAAATTTTAGG - Intergenic
983725561 4:170919988-170920010 TTTAGTTTGTTTCAAATTTTTGG - Intergenic
983744172 4:171174758-171174780 TTGGCTTAGCCTCAAATTTTAGG + Intergenic
984133890 4:175912168-175912190 TTAACTTTATATGAAATTTTGGG + Intronic
984160266 4:176244206-176244228 TTGAGTCTGAATAAAATTTTAGG - Intronic
984498038 4:180523021-180523043 TTGACTGGGAATCAAATTTATGG + Intergenic
984797883 4:183681846-183681868 TTGACCTAGAATTTAATTTTTGG + Intronic
986323411 5:6652416-6652438 ATGAACTTGAATCAACTTTTAGG + Intronic
987211468 5:15688180-15688202 TTATCTTTGAATCACATTTTAGG + Intronic
987250569 5:16096359-16096381 TTTAATTTTAATGAAATTTTGGG + Intronic
987845141 5:23274219-23274241 TTGATTTTTAATCAAATTGTGGG - Intergenic
987944700 5:24589448-24589470 CTGACTTAGAATCAGATTTATGG + Intronic
988105983 5:26748473-26748495 TTGACTTTGGATGCAAATTTTGG + Intergenic
989474069 5:41854403-41854425 TTGACTTTGCTTTAAATTCTAGG - Intronic
990059102 5:51625117-51625139 TTCTCTTTCAATCATATTTTGGG - Intergenic
990540690 5:56770124-56770146 TGCACTTTGAAACAAATATTCGG - Intergenic
991478353 5:67048251-67048273 ATTCCTTTGAAGCAAATTTTAGG - Intronic
992071750 5:73155092-73155114 TCTACTTTGAATCAAATTATTGG + Intergenic
992515154 5:77484119-77484141 TTAGCATAGAATCAAATTTTAGG - Intronic
992840126 5:80680758-80680780 TTGGCTTTGAAGCAAATCCTAGG + Intronic
993777883 5:92024398-92024420 ATGAGTTTGAATTAAATTGTAGG + Intergenic
993942627 5:94078630-94078652 TTGCGTTTGGATCAAAGTTTTGG + Intronic
993968241 5:94384841-94384863 TTGTTTTTTAATCAAACTTTTGG - Intronic
993982695 5:94561546-94561568 TTGAATTTGAATTGAATTGTAGG + Intronic
994208596 5:97062862-97062884 TTGACTTTTAAATAAATTTATGG - Intergenic
994473247 5:100236883-100236905 TTGACTTAATATGAAATTTTTGG + Intergenic
994870832 5:105348840-105348862 TTGTCTTTGAAAGAAATTATTGG + Intergenic
995292983 5:110481730-110481752 TAGACTTTGAAGCAAACATTTGG + Intronic
995419039 5:111941960-111941982 TGGACTCTGAATTAGATTTTTGG + Intronic
995577492 5:113555943-113555965 AGGACTTTGAATTAAACTTTTGG + Intronic
996137223 5:119858307-119858329 TTGAACTTGAACCACATTTTAGG - Intergenic
996576426 5:124981413-124981435 ATGACTTTGAACCATATTTGAGG - Intergenic
996808842 5:127490496-127490518 TTCCCTTTCAATTAAATTTTAGG - Intergenic
996808974 5:127492437-127492459 TTTAGTTTAAATTAAATTTTAGG - Intergenic
997369199 5:133346824-133346846 TTGACTTTTAATCTAAGTTGTGG + Intronic
997881413 5:137594592-137594614 TTGACTTTGATTGGAAGTTTTGG - Intronic
998209287 5:140182083-140182105 TTCCCTTTTAAACAAATTTTAGG - Intronic
998706043 5:144762086-144762108 TTGACTTTAAATTAAAATATTGG + Intergenic
1000259539 5:159574129-159574151 TTCATTTTGAATTATATTTTTGG + Intergenic
1000474786 5:161692696-161692718 TTTAATATGAATCAAATTATTGG - Intronic
1000587250 5:163115506-163115528 TTGGCTCTAAATGAAATTTTTGG - Intergenic
1001080967 5:168667045-168667067 TTGACATTTAATTAATTTTTAGG - Intronic
1001105587 5:168851386-168851408 TTAAATTTGAAACAAATTTCTGG + Intronic
1003278452 6:4672209-4672231 TTGACTTAGAAATAAATTTTGGG - Intergenic
1003685399 6:8297402-8297424 TTGTCTTTGAAAGAAATTTCTGG + Intergenic
1003696955 6:8416904-8416926 CTGGCTTTGATTAAAATTTTTGG - Exonic
1003765769 6:9234800-9234822 TTTACTTTATATCAGATTTTAGG + Intergenic
1003844157 6:10155392-10155414 ATGACTTTGAGTCTAATTCTGGG - Intronic
1004353601 6:14912388-14912410 TGGACTTTGTATCAAATTCATGG + Intergenic
1004738747 6:18435068-18435090 TTATCTTTGAATTAAAGTTTGGG + Intronic
1004847263 6:19658700-19658722 TTCACTTTAAATTAAATTATTGG + Intergenic
1005168030 6:22948413-22948435 TTCACTTAGAATCATGTTTTTGG + Intergenic
1005805407 6:29469931-29469953 TTGACTGTGTAAAAAATTTTAGG + Intergenic
1008132265 6:47732385-47732407 GTGACTGAGAATCAAAATTTAGG + Intergenic
1008821262 6:55633873-55633895 TTGACTTAAAAACAATTTTTCGG - Intergenic
1009419749 6:63452167-63452189 TTTTCTTTAAATCAAATGTTTGG + Intergenic
1009521169 6:64683708-64683730 TTGACTTTGTATTAATTCTTTGG - Intronic
1009830617 6:68927456-68927478 TTCACTTTTAATAAAAATTTAGG - Intronic
1010437909 6:75856892-75856914 TAGACTTTTGATCTAATTTTAGG + Intronic
1010448713 6:75978171-75978193 TTGACATTGAATCAAATAATGGG - Intronic
1010531619 6:76975058-76975080 TTCACTTAGAATAAGATTTTCGG + Intergenic
1010605262 6:77881875-77881897 TTGAAATTGAATTAAATTATAGG - Intronic
1011062296 6:83284275-83284297 TTGACTGTGAATCCATTTTCTGG - Intronic
1011961118 6:93091879-93091901 TATACTTTTAATCAGATTTTGGG + Intergenic
1012759555 6:103281443-103281465 TTCTCTTTTAATCAAATGTTTGG + Intergenic
1012799640 6:103808529-103808551 TTGAGTTTAAATAAAATGTTAGG + Intergenic
1012860917 6:104558376-104558398 TTGACTTTTAAACAAATATGAGG - Intergenic
1014693547 6:124591214-124591236 TTGACTTTTAAACAGACTTTTGG - Intronic
1014848383 6:126308966-126308988 AGGACTTTGAACCACATTTTTGG - Intergenic
1015132496 6:129829612-129829634 TTGACTTTGTTTCAACTTATGGG + Intergenic
1015314716 6:131805810-131805832 TTGTCCTTGAATCTGATTTTTGG + Intergenic
1016143243 6:140639710-140639732 TTAAGTTTGAATGATATTTTTGG - Intergenic
1016178662 6:141114755-141114777 TAGACTTTGAACAAAATATTAGG + Intergenic
1017731622 6:157322429-157322451 ATGACTTTGAATCTAAATTTGGG - Intronic
1017961483 6:159225768-159225790 TTGTCTTTAAATCTTATTTTGGG - Intronic
1018080512 6:160255791-160255813 TCAACTATGAAGCAAATTTTTGG + Intronic
1018563524 6:165127585-165127607 ATTTCTTTAAATCAAATTTTTGG + Intergenic
1019391600 7:790534-790556 TTGCCTTTGAATCACAGTGTAGG - Intergenic
1019809928 7:3157912-3157934 TTGACTCTGAACCATATTCTGGG + Intronic
1020700193 7:11472253-11472275 TTGACCTTGAATAAGATTTGGGG - Intronic
1021685355 7:23180593-23180615 TTTATTTTGAAACAAATTTATGG - Intergenic
1026477042 7:70745404-70745426 TTGACTTTGTATCAGGTTTCCGG + Intronic
1027880950 7:83835621-83835643 TTGGCATTCAATCAAATATTTGG + Intergenic
1027899950 7:84099888-84099910 TTCACTTTGAAACATATTTCTGG - Intronic
1028792214 7:94865832-94865854 AAGCCTTTGAACCAAATTTTGGG + Intergenic
1030093830 7:105880056-105880078 TTGACTTTGGATGAAAATTGAGG + Intronic
1031176444 7:118358380-118358402 ATGTTTTTGAAACAAATTTTTGG + Intergenic
1031404678 7:121370049-121370071 GTGATTTAGAATCAAATTTGGGG + Intronic
1031442306 7:121809571-121809593 TTTACTTTAAAAGAAATTTTTGG - Intergenic
1032906101 7:136368732-136368754 TTGACTTTCTATCAACTTTAGGG - Intergenic
1033587661 7:142786493-142786515 CTGACTTTGTCTCAATTTTTGGG - Intergenic
1034399263 7:150851137-150851159 TTGACTTTACATCTAATTCTTGG - Intronic
1034722077 7:153302646-153302668 TTGACCTTGAATGCAATTTAGGG + Intergenic
1034756578 7:153627395-153627417 TAGAAATTGAAACAAATTTTTGG - Intergenic
1035875496 8:3184649-3184671 GTGTCTTTTAATAAAATTTTAGG + Intronic
1036500210 8:9307380-9307402 TTTACTTTGAAATAAATGTTGGG + Intergenic
1037124496 8:15330233-15330255 TTGAATTTTAATCACCTTTTTGG + Intergenic
1037745388 8:21639899-21639921 TTTACTTTGAATCAGAAATTTGG - Intergenic
1038356472 8:26833432-26833454 TTTACTTTGAATTTTATTTTTGG - Intronic
1039717928 8:40131087-40131109 TTGATTTTGTATCACATTTGAGG - Intergenic
1042252250 8:66768468-66768490 TTGATTTTGAAGGATATTTTTGG + Intronic
1043188563 8:77187187-77187209 TTGACTTATAATGAAATTTCTGG + Intergenic
1043628543 8:82295976-82295998 TTGAATTTGCATTAAATTCTTGG + Intergenic
1044011217 8:86996208-86996230 TTGACTGTGATTCATGTTTTGGG + Intronic
1044041487 8:87374303-87374325 TTGATTTTCACTCAATTTTTAGG + Intronic
1044845700 8:96378647-96378669 TTGCCTTTTAATCTAAATTTTGG - Intergenic
1045153728 8:99441215-99441237 TTGTCTTTGCTTCACATTTTGGG - Intronic
1045199328 8:99963449-99963471 TTGACTGTAAATCAAGTTTTAGG + Intronic
1045614495 8:103892808-103892830 TTCACTTTCAATTAAAATTTGGG - Intronic
1046492934 8:114976596-114976618 TCTATTTTGAATCAATTTTTAGG - Intergenic
1046902484 8:119538215-119538237 TTGACTTTGGAACAAACTGTTGG + Intergenic
1047377374 8:124314457-124314479 TTGACTTTTAAACAAATCATTGG - Intronic
1048035985 8:130677545-130677567 TTGAATTTGAAAGAGATTTTTGG + Intergenic
1048589197 8:135805313-135805335 TTGACTTTGAATCACCTCTATGG + Intergenic
1049131785 8:140851548-140851570 TTTACTTTTAATAAAATTTGGGG - Intronic
1049185971 8:141253759-141253781 TTGACGTTGAATTACAGTTTTGG - Intronic
1050281401 9:4053970-4053992 TTGACCTTGAAGTAAATTCTTGG - Intronic
1051023998 9:12583723-12583745 TTGTCTTTGTTTCAAAGTTTAGG - Intergenic
1051499447 9:17761187-17761209 TATATTTTGAAACAAATTTTAGG + Intronic
1051799404 9:20914913-20914935 TTGATTTTGAATCTATTTTAAGG + Intronic
1051857471 9:21585471-21585493 TTGACTCTAAATTAATTTTTAGG - Intergenic
1052410059 9:28111525-28111547 TTGACTTATAATCATGTTTTAGG + Intronic
1052527247 9:29634022-29634044 TTCAATTTGAATAACATTTTTGG + Intergenic
1052576341 9:30296694-30296716 TCAACTTTGGGTCAAATTTTAGG + Intergenic
1052609545 9:30755470-30755492 GAGACATTTAATCAAATTTTGGG - Intergenic
1053328515 9:37180113-37180135 TTGAATTTGAATTAAAAATTAGG + Intronic
1053635629 9:39997852-39997874 TCAAGTTTGAATCAAATATTAGG + Intergenic
1054208257 9:62252847-62252869 TCAAGTTTGAATCAAATATTAGG - Intergenic
1054316501 9:63594970-63594992 TCAAGTTTGAATCAAATATTAGG + Intergenic
1054549028 9:66378276-66378298 TCAAGTTTGAATCAAATATTAGG - Intergenic
1054948224 9:70819855-70819877 TTGTCTTTGAATTATATTTTAGG - Intronic
1055221403 9:73936714-73936736 TTGATTTTGAATAAAATGATTGG + Intergenic
1056724500 9:89102419-89102441 CTGAATTTGAAGAAAATTTTAGG + Intronic
1057536281 9:95910672-95910694 TTCACTTTGAATATAATTATTGG + Intronic
1058552245 9:106127326-106127348 TTGAGTTTGTATGAATTTTTGGG + Intergenic
1059560079 9:115325664-115325686 TAGAATTTGAAGCAAATCTTTGG - Intronic
1060314512 9:122496831-122496853 GTGACTTTGAATAAAATGATAGG + Intergenic
1061968711 9:134031702-134031724 TGGACTCTGAATCAATTTTATGG + Exonic
1186089524 X:6029752-6029774 TTCAATTTAAATCACATTTTAGG - Intronic
1186193787 X:7091784-7091806 TTTACTTTGAATCACTTTTCGGG + Intronic
1186473177 X:9836994-9837016 TTGACTCCGCATCATATTTTCGG + Intronic
1186908310 X:14134773-14134795 TTAACTTAGCATCAAGTTTTGGG + Intergenic
1189539752 X:41973455-41973477 TTGAGGGTGAATCAACTTTTTGG + Intergenic
1189551160 X:42095160-42095182 TTTGATTTCAATCAAATTTTGGG + Intergenic
1190380227 X:49832756-49832778 CTGTCTTTGAATCAAGTATTTGG - Intronic
1193454950 X:81720103-81720125 TTATATTTGAATCAAATTTTGGG + Intergenic
1193650005 X:84119806-84119828 TTTATTTTAATTCAAATTTTGGG - Intronic
1193667352 X:84338257-84338279 TGGACTTTGCATCAAAATTCTGG - Intronic
1194701293 X:97118305-97118327 TTGAATTTGAATCAAACATAGGG - Intronic
1195780292 X:108454920-108454942 ATGATTTTAAAGCAAATTTTAGG + Intronic
1195909212 X:109872458-109872480 GTGACTTTCAATCAACTTTGGGG + Intergenic
1196251610 X:113467555-113467577 TTGACGAAGAAGCAAATTTTGGG - Intergenic
1197020849 X:121686397-121686419 TTGATTTTAAAGCAAATTGTTGG + Intergenic
1197261194 X:124320124-124320146 TTGACTTTAAAACAGATTATTGG + Intronic
1198805347 X:140488579-140488601 TTGACACTGGACCAAATTTTGGG + Intergenic
1199015970 X:142815730-142815752 TTGACTTAGAAAAAAATCTTTGG + Intergenic
1199547903 X:149027280-149027302 TTAGCTTGGAATAAAATTTTAGG - Intergenic
1199875657 X:151925889-151925911 TGGTCTTTGACTCAAATTCTAGG + Intergenic
1200714994 Y:6528688-6528710 TTCCCTTTAAATCAAATTATGGG + Intergenic
1200826240 Y:7645826-7645848 TTCCCTTTCAATCAAATTATGGG - Intergenic
1201018830 Y:9632443-9632465 TTCCCTTTAAATCAAATTATGGG - Intergenic
1201060790 Y:10044465-10044487 TTCCCTTTGAATCAAATTATGGG - Intergenic
1201565749 Y:15363645-15363667 TTTACTTTGAATCACTTTTCAGG + Intergenic
1202106652 Y:21376371-21376393 TTCCCTTTCAATCAAATTATGGG - Intergenic
1202194483 Y:22284606-22284628 TTCTCTTTCAATCAAATTATGGG - Intergenic
1202200982 Y:22347611-22347633 TTCCCTTTCAATCAAATTATGGG + Intronic