ID: 917595428

View in Genome Browser
Species Human (GRCh38)
Location 1:176524563-176524585
Sequence AAAGACTTCCTGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 2, 2: 9, 3: 81, 4: 462}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917595428 Original CRISPR AAAGACTTCCTGAAGGAGGA AGG Intronic
900618113 1:3574428-3574450 AAGGGCTTCCTGGAGGAGGTGGG - Intronic
900960345 1:5915111-5915133 AGAGAAGTCCTGAGGGAGGAGGG + Intronic
901113247 1:6816524-6816546 AGAGGCTTCCTGAAGGGTGAGGG + Intronic
901230088 1:7636983-7637005 GAAGGCTTCCTGGAAGAGGAGGG + Intronic
901404433 1:9036876-9036898 AAACACTGCCTGAATGAGCAGGG + Exonic
902081971 1:13827374-13827396 GAAAGCTTCCTGGAGGAGGAGGG + Intergenic
902292360 1:15443582-15443604 AGAGCCTTCCTGAAGGAAGCAGG + Intronic
902605492 1:17566839-17566861 AAAGATTTGCTGAATGAGCAAGG + Intronic
902668234 1:17954123-17954145 AAAGACGGGCTGGAGGAGGAGGG + Intergenic
903293102 1:22326986-22327008 GAAGGCTTCCTGGAGGAGGCAGG - Intergenic
903341247 1:22655860-22655882 AAAGGTTTCCTGGAGGAAGAAGG + Intronic
903461876 1:23526016-23526038 GAAGACTTCCTGGAGGGGGCAGG - Intronic
903517756 1:23923753-23923775 GAAGACTTCCTGGAGGAAGAAGG - Intergenic
903971566 1:27122330-27122352 GAACACTTCCTGAAGGATGTAGG + Intronic
904499252 1:30904776-30904798 GAAGGCTTCCTGGAGGAGGAGGG - Intronic
905217653 1:36420886-36420908 ATACACTTCTTCAAGGAGGAAGG - Intronic
906156211 1:43615469-43615491 GAAGGCTTCCTGGAGGAGGAGGG - Intronic
906367340 1:45221997-45222019 AAAAACTTGCTGAAGGACGCAGG + Intronic
906796007 1:48696902-48696924 AAGGGCTTCCTCAGGGAGGAGGG - Intronic
906988148 1:50709043-50709065 AAAGACTTCCTGAGGTTTGAAGG + Intronic
907443314 1:54491355-54491377 GAAGACTTCCTGCAGGAGAGGGG + Intergenic
907476542 1:54709747-54709769 GAAGGCTTCCTGGAGGAGGCAGG + Intronic
907517525 1:55002021-55002043 AAAGACATCCAGAAGAAGGAAGG + Intronic
908063471 1:60376325-60376347 AAAGACTTGTTGAGGTAGGAAGG - Intergenic
908746345 1:67380342-67380364 GAAGGCTTCCTGAAGGAGGAAGG - Intronic
909346968 1:74601607-74601629 GAAGACTTCCCAAAAGAGGAAGG + Intronic
910046822 1:82927617-82927639 AAAGAATTAATGAAGGAGGATGG - Intergenic
910243081 1:85109500-85109522 ACAAACATCCTGAAGGAGAAAGG + Intronic
910746248 1:90578046-90578068 AAAGACTTATTCAAGGAGTATGG + Intergenic
911286147 1:95995603-95995625 ATAAACATCCTGAAGGAGGTTGG + Intergenic
911434978 1:97845183-97845205 AGGGACTTCCTGAAGCATGAGGG + Intronic
911704583 1:100996682-100996704 AAAGACTTTATGAAGGAGTTAGG - Intronic
912774563 1:112497268-112497290 AAAGACTTGCTGCAGGAACAGGG - Intronic
913052306 1:115128528-115128550 TATGACTTCCTGAAGGCAGAAGG - Intergenic
914708857 1:150194603-150194625 AGAGACTGCCTGAAGGTGGGTGG + Intergenic
914947977 1:152082727-152082749 GAATACTTCTTGAAGGATGATGG + Intergenic
915392917 1:155560990-155561012 AAAGACTTCCTGAGGCACCATGG + Intronic
915409073 1:155686908-155686930 AAAGACTTCCTGAGGCACCATGG + Intronic
915610046 1:156984525-156984547 AAAGGCTTCTTGAAGAAGAAAGG - Intronic
916815014 1:168343252-168343274 GAAGGTTTCCTGAAGAAGGAGGG + Intergenic
916815158 1:168344507-168344529 GAAGGTTTCCTGAAGAAGGAGGG - Intergenic
917595428 1:176524563-176524585 AAAGACTTCCTGAAGGAGGAAGG + Intronic
918496926 1:185150580-185150602 AAAGACTTTAAGAAGTAGGAGGG - Intronic
919347399 1:196402063-196402085 AAAAACTCCCTCAAAGAGGAAGG + Intronic
919730121 1:200908501-200908523 GGAGGCTTCTTGAAGGAGGAAGG + Intronic
919987899 1:202688720-202688742 AAGAACTTCCTGATGGTGGAAGG + Intronic
920686889 1:208116170-208116192 GAAGACTTCCTGGAGGAGGGAGG - Intronic
921824341 1:219655338-219655360 ATAGACTTCCCTAAGGAGGAAGG - Intergenic
922338776 1:224638916-224638938 AGAAACTTCCTGGAGGAGGAAGG - Intronic
922406673 1:225321523-225321545 ACAGACTTCCCAAAGAAGGAAGG - Intronic
923458247 1:234185126-234185148 AAATACTTGCAGAAGGAGGAGGG + Intronic
924335160 1:242980277-242980299 AAAGACTTCCTGGATGAGGTTGG + Intergenic
1062768204 10:81049-81071 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1062964906 10:1599709-1599731 AAAGGCTTCCAGACAGAGGAAGG - Intronic
1063172111 10:3518112-3518134 AAAGACATCCTGCAGGAGGTGGG + Intergenic
1063392512 10:5659622-5659644 GGAGGCTTCCTGAAGGAGCAGGG - Intronic
1064312144 10:14221063-14221085 AAAGACTTCCTGAATAAACATGG + Intronic
1065292003 10:24239986-24240008 AAAGACTTCTTGGAGGAAGGTGG + Intronic
1068535885 10:58241159-58241181 AACGACTTGCTGAAGGCAGAAGG + Intronic
1068634653 10:59335371-59335393 AAAGACTTCCTCAAAGTGAATGG - Intronic
1069249774 10:66254141-66254163 ATACACTCCCTGAAGGATGAAGG + Intronic
1069531167 10:69220630-69220652 AAAGACTCACTGAGGGAAGAGGG + Intronic
1069580304 10:69561317-69561339 TGAGACTTCCTGGAGGAGGTAGG - Intergenic
1070560658 10:77564215-77564237 AAAGGCTTCCTGCAAGAGGAAGG + Intronic
1070648824 10:78220441-78220463 GAAGGCTTCCTGGAGGAAGAAGG + Intergenic
1071251328 10:83822826-83822848 GAAACCTTCCTGAAGGAGGCAGG + Intergenic
1071473157 10:86001571-86001593 AAAGATTTCCTGAAGGAATTTGG + Intronic
1072486722 10:95863176-95863198 ACAGATTTCCAGAAGGAGGAGGG + Intronic
1072800716 10:98390630-98390652 AAAGGCCTGATGAAGGAGGAGGG + Exonic
1072825492 10:98601999-98602021 CATGACTTTCTGAAAGAGGAAGG + Intronic
1073055390 10:100697153-100697175 GAAGACTTCCTGGAAGAGGTGGG - Intergenic
1073477726 10:103765293-103765315 AGAGACCTCCTGAACGAGGGGGG - Intronic
1073574820 10:104613535-104613557 GAAGAATTCCTGGAGAAGGAGGG - Intergenic
1074035881 10:109737966-109737988 GAAGACTTCATTGAGGAGGAGGG + Intergenic
1075001877 10:118804757-118804779 GAAGGCTTCCTGGAGGAGGTGGG + Intergenic
1075600190 10:123761910-123761932 GAGGACTTCCAGAAGGAGGAGGG - Exonic
1075788499 10:125066594-125066616 AAAGTCTGCCTGGTGGAGGAGGG + Intronic
1077552593 11:3207734-3207756 AAAGGCTGCCTGCAGGAGGAGGG - Intergenic
1077610185 11:3639177-3639199 AAAGAGTTCCTGGAGGACGGAGG - Intronic
1078138630 11:8673904-8673926 CAAGCCTTCAGGAAGGAGGAAGG + Intergenic
1078421309 11:11215357-11215379 AAAGGCTTCACAAAGGAGGAAGG + Intergenic
1078922731 11:15845457-15845479 AAAGAAGTCCTGAAGGTGGATGG - Intergenic
1080001121 11:27351473-27351495 GAAGACTTCCTGAGTGAGGGCGG - Intronic
1080952726 11:37054654-37054676 AAATCCTTCCTGAAAAAGGAAGG - Intergenic
1081416084 11:42817867-42817889 AAAGGCTTCTTGAAAGAGTAGGG + Intergenic
1081639965 11:44746269-44746291 AAAGACTCCCTGACAGAGGCTGG - Intronic
1081675157 11:44964298-44964320 GAAGACTTCCTGCAGGAGGTGGG - Intergenic
1083190511 11:61048617-61048639 GAAGGCTTCCTGGAGGAGGCAGG - Intergenic
1084209186 11:67613131-67613153 AAAGAATTCCTGCAGGGAGAAGG + Intergenic
1084798966 11:71528573-71528595 AAAAACTTCCCAAAGGAAGATGG - Exonic
1084962726 11:72725827-72725849 GAAGGCTTCTTGGAGGAGGAAGG - Intronic
1085745747 11:79112818-79112840 GAAGACTTCCTGGAGGAGGTGGG - Intronic
1085758449 11:79221115-79221137 AAAGGCATCCTGAAGGGGCATGG + Intronic
1085802480 11:79603235-79603257 GAAGGCTTCCTGGAGGAGGAGGG - Intergenic
1086017946 11:82190109-82190131 AAATACTTCTTGTATGAGGAAGG + Intergenic
1086255679 11:84873615-84873637 AAAGATTTCCTGAAAGATTAGGG + Intronic
1086261972 11:84950460-84950482 ATAGACTTCCTGAAAGTAGAAGG + Intronic
1086726310 11:90189072-90189094 AAAGTCTTCCTGTAAGAGGCAGG + Intronic
1087295642 11:96370056-96370078 AAAGACTTCAAGTTGGAGGATGG - Intronic
1089170544 11:116508465-116508487 AAAGGCTTCCTGGAGGAAGTGGG - Intergenic
1089647473 11:119889687-119889709 AAGGACTCCCAGAGGGAGGATGG - Intergenic
1091157891 11:133390629-133390651 GAAGACTTCCTGGAAGAGGTGGG + Intronic
1091218800 11:133918917-133918939 AAAGACTGACTGGAGAAGGAAGG + Intronic
1091863224 12:3805739-3805761 GAAGACTTCTTGAAAGACGAGGG + Intronic
1092928294 12:13291830-13291852 AAGAACTTCCTGAAGAAGTAGGG - Intergenic
1095183514 12:39174436-39174458 GAAGAATTCCTGGAGGAGGTTGG + Intergenic
1095681432 12:44981048-44981070 GAAGACTACCTGAGTGAGGAGGG + Intergenic
1096181976 12:49556075-49556097 GAAGGCTTCCTGGAGGAGGCAGG - Intronic
1096510089 12:52122893-52122915 AAAGACATGTAGAAGGAGGAAGG - Intergenic
1096618765 12:52849301-52849323 GAAGGCTTCCTGAAGGAGACAGG + Intergenic
1097969609 12:65619009-65619031 AAAGGCTTCTCGGAGGAGGAAGG + Intergenic
1098169315 12:67730723-67730745 AGAGACTTCATGGAGGAGGCAGG + Intergenic
1098190663 12:67945167-67945189 GAAGGCTTCCTGGAGGAGGAGGG + Intergenic
1098507637 12:71272529-71272551 GAAAGCTTCCTGGAGGAGGATGG - Intronic
1099451577 12:82814257-82814279 AAAGACTTCCTGGAGGAAATGGG + Intronic
1099648746 12:85396365-85396387 GAAGATTTCATGAAGGAGGTAGG - Intergenic
1100783229 12:98051574-98051596 AAAGACTTCTAGAAAGAAGATGG - Intergenic
1101849453 12:108390673-108390695 GCAGGCTTCCTGGAGGAGGAGGG + Intergenic
1102240509 12:111321875-111321897 GAAGGCTTCCTGGAGGAGGGGGG + Intronic
1102625061 12:114228253-114228275 AAAGACTGACTTAAGGAGGGTGG - Intergenic
1102952878 12:117041939-117041961 GAGGACTTCCTGAAGGTGGGTGG - Exonic
1104133665 12:125917737-125917759 GAAGATGTCCTGAGGGAGGAGGG + Intergenic
1104391297 12:128392602-128392624 GAAGACTTCCTGGAGGAGGTGGG + Intronic
1104657999 12:130588166-130588188 AAGGGCTTCCTGGAGGAGGCAGG - Intronic
1105845885 13:24293391-24293413 AAAGACTTCTTGAAAGACGTGGG + Intronic
1105914113 13:24896274-24896296 AATGAGTTCCTGAAGAGGGACGG + Intronic
1106749849 13:32751033-32751055 AAAGCCTTCTTGAGGGTGGAGGG - Intronic
1108301839 13:49085392-49085414 AAAGACATCCTGAGAGAAGAGGG - Intronic
1108691837 13:52866181-52866203 AGTGCCTACCTGAAGGAGGAGGG + Intergenic
1110293881 13:73840038-73840060 AAAGACTGCCTGAAGTAAGTTGG - Intronic
1111002283 13:82200337-82200359 ACAGACTTCCTGGTGGAGGAGGG + Intergenic
1111515692 13:89328086-89328108 AAAGTGTTGCTGAAGGAGAAGGG - Intergenic
1113695047 13:112339379-112339401 AATGATTAGCTGAAGGAGGAAGG + Intergenic
1115805881 14:37051255-37051277 AAAGAATACCTGAGGGAGAAGGG + Intronic
1117486133 14:56199108-56199130 ACAGAATTCTTGTAGGAGGAAGG - Intronic
1120819942 14:88902821-88902843 ACAGACTTACAGAAGGTGGAGGG + Intergenic
1121279639 14:92689291-92689313 AAAAGCTTCCTGGAGGAGGTTGG - Intergenic
1121326219 14:93021288-93021310 ACAGACTTCCAGAAGGATGTTGG + Intronic
1121380492 14:93461836-93461858 AAAGACCTCCATAATGAGGAAGG + Intronic
1121634826 14:95446793-95446815 GAAGGCTTCCTGGAGGAGGTAGG - Intronic
1121866418 14:97366620-97366642 GAAGACTTCCTGGAGGAGGAGGG - Intergenic
1122039241 14:98971106-98971128 AAACACTCCCTGAAGGTGGGTGG - Intergenic
1122863913 14:104594988-104595010 GAAGGCTTCCTGCAGGAGGTGGG - Intronic
1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG + Intergenic
1123023535 14:105413045-105413067 GAAGGCTTCCTGAAGGAGGAGGG - Exonic
1123681253 15:22765761-22765783 AAAGCCTTCCTGAGGGCTGAAGG - Intergenic
1123681312 15:22766092-22766114 AGAGGCTTCCAGGAGGAGGAGGG + Intergenic
1124333526 15:28840554-28840576 AGAGGCTTCCAGGAGGAGGAGGG + Intergenic
1124366407 15:29074563-29074585 GAAGACATTCTGAAGGTGGATGG + Intronic
1125375547 15:39024991-39025013 ACGGGCTTCCTGAAAGAGGAAGG + Intergenic
1125532785 15:40424439-40424461 GAGGTCTTCCTGAAGGAGGCAGG - Intronic
1127778354 15:62287779-62287801 GAAGACTTCATGAAGTAGGTGGG - Intergenic
1127902980 15:63354836-63354858 AAGGACTTCCTGAGGGTGGGTGG - Intronic
1127905725 15:63374351-63374373 GAAGGCCTCCTGGAGGAGGAGGG - Intronic
1128214650 15:65925827-65925849 GAAGGCTTCCTGGAGAAGGAGGG - Intronic
1128327024 15:66730342-66730364 GAAGGCTTCCTGGAGAAGGAAGG - Intronic
1128729913 15:70014128-70014150 GAGGCCTTCCTGGAGGAGGACGG - Intergenic
1129158558 15:73733888-73733910 AAAGGCTTCTGGAAGGAGGGAGG - Intergenic
1129168829 15:73795643-73795665 GAGGGCTTCCTGGAGGAGGAAGG + Intergenic
1129677588 15:77640738-77640760 AGAGGCTTCCTGGGGGAGGAGGG + Intronic
1129707012 15:77800083-77800105 GAAGGCTTCCTGATGGAGGAGGG + Intronic
1129993229 15:79982849-79982871 AAAGACTTCCAGAAAGAAGGCGG + Intergenic
1130031391 15:80317713-80317735 CAAGAATTCCCCAAGGAGGAGGG + Intergenic
1130064471 15:80592722-80592744 AAGGCCTTACAGAAGGAGGAAGG - Intronic
1130090528 15:80817086-80817108 AAAGCCATGGTGAAGGAGGAAGG + Intronic
1130397275 15:83513566-83513588 AAAGACTTTCTAAAGGAAGGAGG - Intronic
1130857939 15:87857842-87857864 AAGGACTTCCTGAAGAAAGATGG + Intergenic
1131274010 15:90965442-90965464 ACAGCGTTACTGAAGGAGGATGG - Intergenic
1131631022 15:94176847-94176869 AAGGAATTCCTGAAATAGGAGGG - Intergenic
1132457104 16:30025-30047 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1132984846 16:2759979-2760001 GAAGGCTTCCTGAAGGAGGTGGG + Intronic
1133088905 16:3388328-3388350 AAAGACTTGCTGAAGGAGGAGGG - Intronic
1133115478 16:3575975-3575997 AAAGCCTTCCCGAAGGAAGAAGG + Intronic
1133237550 16:4394548-4394570 ATAGATGGCCTGAAGGAGGACGG - Intronic
1134617337 16:15661738-15661760 AAAGACTTCCAGAAGGTGGCTGG - Intronic
1134626453 16:15726077-15726099 AAAGGCTTCCCTAAGGAGCATGG - Exonic
1135558007 16:23453198-23453220 AACGACTTCCGGAAGAAGAACGG - Intergenic
1137477057 16:48818157-48818179 GAAGGCTTCTTGAAGGAGGTGGG + Intergenic
1137611753 16:49822716-49822738 GAAAACTTCCTGGAGAAGGATGG - Exonic
1138045673 16:53722083-53722105 AAACGCTTCATGAAAGAGGAGGG - Intronic
1138450496 16:57091353-57091375 AAAGTCTTCCTGGAGGAAGCGGG + Intergenic
1138516794 16:57540585-57540607 GAAGCCTTCCTGGAGGAGGCAGG + Intergenic
1138791788 16:59912943-59912965 TAAGATTTCATCAAGGAGGAAGG + Intergenic
1138795962 16:59969262-59969284 GAAGAATTCCTGAAGGATGCTGG - Intergenic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1140217937 16:73023327-73023349 AGAGACTGCCTGGAGGTGGAAGG + Intronic
1140756537 16:78072385-78072407 AAAGCCTACCTGAAGGAGTTAGG + Intergenic
1141368271 16:83464161-83464183 AGAGACTGCCTGAACCAGGACGG - Intronic
1141466034 16:84206383-84206405 CAAGAATTCCTGGAGGAGGGAGG - Intergenic
1141592524 16:85078075-85078097 TAAGACTTCCACAAGGAAGAGGG + Intronic
1141633836 16:85303428-85303450 GAGGGCTTCCTGCAGGAGGAGGG - Intergenic
1141999838 16:87658007-87658029 AAAGACTTCCTGGGTGTGGAGGG + Intronic
1142134869 16:88447184-88447206 AAAGACTGCCTGGAGGTGGGGGG - Intergenic
1142955842 17:3521211-3521233 GAAGGCTTCCTGGAGGAGGCAGG - Intronic
1143050513 17:4121696-4121718 AAAGACAACCTGAAGGAGAATGG + Intronic
1143378106 17:6479107-6479129 GCAGACTTCCTGGAGGAGGTGGG + Intronic
1143944616 17:10579328-10579350 AGAGACGTCCTGGAGGAGGAGGG + Intergenic
1144194008 17:12873326-12873348 AAAGGCTTCCTGGAGGAGGAGGG - Intronic
1144264524 17:13555222-13555244 AAAGACTTCCTGGAGTGGAATGG - Intronic
1144965980 17:19077622-19077644 AAAGGCTCACTGGAGGAGGAGGG + Intergenic
1144981988 17:19174567-19174589 AAAGGCTCACTGGAGGAGGAGGG - Intergenic
1144986235 17:19203672-19203694 AAAGGCTCACTGGAGGAGGAGGG + Intergenic
1146065292 17:29630308-29630330 TTAGAGTTCCTGAAGGAGGCAGG - Exonic
1147262955 17:39219383-39219405 AGAGAGTTCCTGGAGGAGGAAGG - Intronic
1148289468 17:46431569-46431591 GAAAACTTCATGAAGGCGGAAGG - Intergenic
1148311637 17:46649141-46649163 GAAAACTTCATGAAGGCGGAAGG - Intronic
1148335448 17:46837901-46837923 AAAAAGTGCCTGGAGGAGGAGGG + Intronic
1148521018 17:48275016-48275038 AAAGAGTTGGTGGAGGAGGAGGG - Intronic
1148996450 17:51714469-51714491 AAAGAGCTCCAGAGGGAGGAAGG - Intronic
1149783557 17:59417166-59417188 AAAGAGTGACTGGAGGAGGAAGG - Intergenic
1150599105 17:66635038-66635060 AGAGACTTCCTGGAGGAGGAAGG + Intronic
1151573170 17:74937259-74937281 AAAGACTTCCGGAACGAGGCTGG - Intronic
1151817088 17:76476734-76476756 AAACACTTGCTGAATGAGTAAGG + Intronic
1152009763 17:77705172-77705194 AAAGACTACCAGGAGGAGGAAGG - Intergenic
1152743273 17:82027881-82027903 GAAGCCTTCCTGGAGGAGGCGGG + Intronic
1152961093 18:80546-80568 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1154230248 18:12549950-12549972 AATGACTTCTTGAAGAAGAATGG - Intronic
1154388520 18:13916876-13916898 AGAGACTTCCAGCAGGGGGAAGG + Intergenic
1155280625 18:24235970-24235992 AGAGACTTCCAGATGGAGGATGG + Intronic
1155285510 18:24284880-24284902 GAAGGCTTCCTGGGGGAGGATGG - Intronic
1155370177 18:25090909-25090931 AAAGAGTTCCAAAAGAAGGATGG + Intronic
1155564963 18:27123882-27123904 AAAGAATTCCTGAGAGAGGTGGG - Intronic
1156460073 18:37316658-37316680 AAGGGCTTCCTGGAGGAGGTGGG - Intronic
1156478807 18:37423410-37423432 GAAGACTGCCTGGAGGAGGCGGG + Intronic
1156721984 18:40081446-40081468 GAAGACTTCATGCAGGAGGTAGG + Intergenic
1157294790 18:46434810-46434832 GAGGCCTTCCTGGAGGAGGAAGG + Intronic
1157876495 18:51278773-51278795 GAAGACTTCCTGGAGGTGGTGGG - Intergenic
1157999074 18:52595005-52595027 TAAGACTACCTGAAGGATCAAGG + Intronic
1158098535 18:53803530-53803552 AAAGACATCCTAAATTAGGATGG + Intergenic
1158409614 18:57193775-57193797 AAAGACTTCATGTAGAGGGAGGG - Intergenic
1158415800 18:57248827-57248849 ACAGGCTGCCTCAAGGAGGATGG + Intergenic
1159209865 18:65304613-65304635 AAAGCTTTCTTGAAGGAGAAAGG - Intergenic
1160469196 18:79112914-79112936 AAAGACTTACTAAATGAGTATGG + Intronic
1160696326 19:486359-486381 AAGGCCTTCCTGGAGGGGGAGGG - Intergenic
1161096108 19:2392030-2392052 AAAGACTTCCTGATGGGGCGTGG - Intronic
1161701064 19:5795605-5795627 GAAGGCTTCCTGTAGGAGGAGGG + Intergenic
1161731004 19:5960580-5960602 AAACACTTCATGAAGGGGGAGGG + Intronic
1162973585 19:14195618-14195640 GAGGGCTTCCTGAAGGAGGCGGG - Intronic
1164683175 19:30149531-30149553 GAAGGCTTCCTGGAGGGGGAGGG + Intergenic
1164881446 19:31735629-31735651 CAAGACTTCATGAAGTAGGGAGG - Intergenic
1165124927 19:33587316-33587338 AAAGACTTACTGAGACAGGATGG - Intergenic
1165956537 19:39504879-39504901 GAAGCCTTCCTGGAGGAGGTGGG + Intronic
1166324714 19:42042186-42042208 AAAGGCTTCCTGCAGGAGGCAGG - Intronic
1167646793 19:50710362-50710384 GAAGACTTCCTGGAGGAAGGGGG + Intronic
1168237436 19:55072090-55072112 ACAGGCTGCCTGGAGGAGGAGGG - Intronic
1168285499 19:55330308-55330330 AAAGATTTGCTGAATGAGGCTGG - Intronic
1168342811 19:55635398-55635420 AAAAGGTTCCTGAAGGAGGCAGG + Intronic
925326951 2:3030525-3030547 AAAGAATGGCTAAAGGAGGAGGG + Intergenic
925522725 2:4765670-4765692 AAAATATTTCTGAAGGAGGATGG + Intergenic
925622852 2:5810880-5810902 AAAGTCTTCCTGGAGGAGGAGGG + Intergenic
926148343 2:10410726-10410748 AAAGACTTCCTGAGAAATGAAGG + Intronic
926309571 2:11665791-11665813 AAAGACTTTCCGAAGAGGGAGGG + Intronic
927045486 2:19274085-19274107 AAAAACTACCTGTAGGGGGAGGG - Intergenic
927208676 2:20625605-20625627 AGAGGCTTCCTGAAAGAGGGGGG - Intronic
927398002 2:22677299-22677321 AAAGACTTCTTAGAGGAAGAGGG + Intergenic
927471505 2:23380983-23381005 GATGCCTTCCTGGAGGAGGAAGG - Intergenic
928063733 2:28141599-28141621 GAAGAATTCCAGAAGGAGCAAGG + Intronic
928810027 2:35212861-35212883 AAAGTCTTCCAGCAGGAGGGTGG - Intergenic
930013706 2:46956711-46956733 GAAGGCTTTCTGGAGGAGGAGGG + Intronic
930059002 2:47273084-47273106 GCAGACTTCCTGGAAGAGGAAGG - Intergenic
930311840 2:49751961-49751983 AAATACTTCCAGAAGAAGTATGG + Intergenic
930340173 2:50103133-50103155 AAAGACTTCCTGAATCAACAGGG + Intronic
930511398 2:52349827-52349849 AAAGACTTCCTGAGTGAGGGGGG - Intergenic
930928249 2:56847991-56848013 AAAGCCTTCCTGTTGGAGGGTGG + Intergenic
932192411 2:69752063-69752085 GAAGGCTTCCTGGAGGAGGAAGG + Intronic
932409272 2:71535555-71535577 GAAGGCTTCCTGGAGGAGGTGGG + Intronic
932421134 2:71602112-71602134 CAAGACCTCCAGAAGAAGGAAGG - Intronic
932501332 2:72185433-72185455 ATGAACTTCCTGAAGCAGGATGG + Intronic
932667652 2:73709892-73709914 AAAGACCTCCTGACAGGGGAAGG + Intergenic
932769121 2:74490642-74490664 ATTGGCTTCCTGAAGGACGAAGG - Exonic
932771756 2:74504285-74504307 AAAGAATTCCTGAAGGTAGCCGG - Intergenic
933298779 2:80520084-80520106 ACAGCATTCCTGGAGGAGGAGGG - Intronic
933450819 2:82448284-82448306 AAATAGTTCCTGAAGGAATAAGG + Intergenic
936025321 2:109027276-109027298 GAAGACTTCTTGAAGGAGGGTGG + Intergenic
936980574 2:118261595-118261617 AAAATCTTCCTGAAGGCAGAGGG + Intergenic
937216543 2:120316871-120316893 AAAGACTTCGCTAAAGAGGAAGG - Intergenic
937239280 2:120449989-120450011 GAGGGCTTCCTGAAGGAGGTGGG + Intergenic
937868122 2:126769050-126769072 AAAGCCTTCATGAAGGATGGTGG - Intergenic
937953979 2:127408723-127408745 GAAGACTTCCTGGAGGAGGCGGG - Intergenic
938312449 2:130301970-130301992 GGAGACCACCTGAAGGAGGAAGG - Intergenic
938313443 2:130310072-130310094 GGAGGCTTCCTGAAGGAGGCAGG - Intergenic
939622286 2:144435187-144435209 AAATGCTTCCTCAAGTAGGAAGG + Intronic
939722901 2:145677240-145677262 AAAGGCCTGCTGTAGGAGGAAGG - Intergenic
941300290 2:163792785-163792807 TAAGACTTTTTGAAGGAGAATGG - Intergenic
941667814 2:168259765-168259787 AAAGTCTACCTGGGGGAGGATGG - Intergenic
943775004 2:191755786-191755808 AAAGAAGTCCTGAAGTTGGAGGG + Intergenic
944957470 2:204828957-204828979 AAAGACTTCATGCAGAAGGCTGG - Intronic
945965330 2:216180629-216180651 AAAGAATTCCTGGAGGAGGTTGG + Intronic
946075510 2:217070356-217070378 AGAGCCTTCGGGAAGGAGGAAGG - Intergenic
946321463 2:218957079-218957101 AAAGACTTCATGGAGGAGGTGGG - Intergenic
946889339 2:224259267-224259289 AAAGCCTTCTTGAAGGAGGTAGG + Intergenic
947384632 2:229578662-229578684 AAAGTCTTCCTGAAGGCAGGGGG - Intronic
947439605 2:230108218-230108240 AAAAGCTTCCTTAAGAAGGATGG - Intergenic
948876682 2:240833218-240833240 AAAGTCTTCATGGAGGAGGAGGG - Intergenic
948914183 2:241022716-241022738 AATGACTTTCTGGAAGAGGAAGG - Intronic
1169282387 20:4278622-4278644 AAAGACTTCCTGGAGGAAGCAGG - Intergenic
1170432814 20:16292619-16292641 CAAGGCTTCATGAAAGAGGAAGG + Intronic
1170657891 20:18306594-18306616 AAAGGCTTCCTAGTGGAGGAAGG - Intronic
1170804467 20:19617616-19617638 CAAGACTGCCTGCAGGAGGGCGG + Intronic
1171166844 20:22979556-22979578 AAAAACGTCCTGAAGGTTGAGGG - Intergenic
1171329505 20:24325266-24325288 GGAGACTTCAAGAAGGAGGAAGG + Intergenic
1172046847 20:32086527-32086549 AAAGACTTTCTGGAGGAGGCGGG + Intronic
1172266280 20:33617409-33617431 ATAAACTAGCTGAAGGAGGAAGG + Intronic
1172511167 20:35502045-35502067 ACAGACTTGCTGAAGGAAGTGGG - Intronic
1173875630 20:46368960-46368982 CAACACCTCCTGAAGGAGAAAGG + Exonic
1174144673 20:48443398-48443420 AAAGACCTCCAGGAGGAGCAGGG + Intergenic
1175137464 20:56835228-56835250 GAAGCCTTCCTGAAGGAGGCAGG + Intergenic
1175249593 20:57601205-57601227 GAAGGCTTCCTGGAGGAGGAGGG - Intergenic
1176036806 20:63043603-63043625 CAAGGCTTCCTGAAGGAAGAAGG + Intergenic
1177269064 21:18821965-18821987 AAAGACTTCCTGATGAAAAATGG - Intergenic
1177437869 21:21080324-21080346 AAAGACTTCCTGGTGGGGCATGG + Intronic
1177509465 21:22065740-22065762 GGAGACTTCCTGAAAGAGGAAGG + Intergenic
1178765618 21:35448228-35448250 GATGACCTCCTGAAAGAGGAAGG - Intronic
1179281008 21:39934295-39934317 AAAGACTTCCTAAAGGGCAATGG - Intergenic
1179786883 21:43735244-43735266 AAATAAATCCTAAAGGAGGATGG - Intronic
1181027624 22:20134899-20134921 GAAGGCTTCCTGAAGGAAGAGGG - Intronic
1181618503 22:24071440-24071462 AAAGACTTCCTGGACGATGCAGG - Intronic
1181760437 22:25054734-25054756 AAAGTCTCCCTGGAGGAGGGAGG + Intronic
1181939214 22:26462423-26462445 AAAGACTTCCTGCAAGTGGCAGG - Intronic
1181960240 22:26617430-26617452 ACAGCCTTCCTGGAGGAGGCTGG - Intronic
1182287785 22:29258539-29258561 AAACACTTCCTAAAGGAGGTGGG + Intronic
1182479232 22:30595949-30595971 AAAGGGTTCCTGAAGGTGGTTGG - Intronic
1183087003 22:35492483-35492505 AAAGACCTCCTGGAGGAGGTGGG - Intergenic
1183235827 22:36616793-36616815 AAAGACTTCATAAAGGAGGCAGG - Intronic
1183292489 22:37011259-37011281 ATGGACTTCCTGACTGAGGATGG - Exonic
1183295865 22:37029260-37029282 ACAGACTTCCTGAGCCAGGAGGG + Exonic
1183303844 22:37071512-37071534 AAAAGCTTCCTGGAGGAGGTAGG - Intronic
1183392435 22:37553098-37553120 GAAGACTGCCTGGAGGAGGTAGG - Intergenic
1183733621 22:39631542-39631564 GAGGACTGCCTGGAGGAGGAGGG + Intronic
1184091616 22:42295883-42295905 AAAGCCTGCCTGGAGGAGGAGGG - Intronic
1184440532 22:44510044-44510066 AAAGGCTTCCAGGAGGAGGTGGG + Intergenic
949586100 3:5439319-5439341 CGTGACATCCTGAAGGAGGATGG + Intergenic
950381711 3:12621046-12621068 AACAAGTTTCTGAAGGAGGAAGG - Intronic
951422563 3:22504602-22504624 AAAGACTGGCTGATGGTGGAGGG - Intergenic
951503960 3:23420758-23420780 AAAGGCTTCCTGAAAGAGGCAGG - Intronic
951622075 3:24613386-24613408 AAATGTTTCCTGAAGGAAGATGG + Intergenic
952244724 3:31574588-31574610 AAATACTTCTTGGAAGAGGAAGG + Intronic
952322300 3:32289447-32289469 GAAGGCTTCCTGGAGGAGGTGGG + Intronic
952890021 3:38033671-38033693 AAATACACCCTGAAGCAGGAGGG + Intergenic
953260788 3:41337300-41337322 AAAGACTCCCTGTATGAGGTTGG + Intronic
953365455 3:42340603-42340625 ATAGACTTTCTGACTGAGGAAGG + Intergenic
953582167 3:44167103-44167125 AAAGGCTTCCCCAAGGAGGTGGG + Intergenic
953925167 3:46979108-46979130 GAAGGCTTCCTGGAGGAGGGAGG + Intronic
954413453 3:50381283-50381305 AAAGTCTTCCTGGAGGAGCTGGG - Intronic
955792234 3:62600483-62600505 AAATACTTCCTGTAAGAGGGTGG + Intronic
955819923 3:62886006-62886028 ATATATTTCCTGAAGAAGGACGG + Intergenic
956080874 3:65554696-65554718 AAAGATTTCATGAAGGAAGTGGG - Intronic
956723712 3:72139765-72139787 AAAGATTTCCCGAAGGTGAAAGG - Intergenic
956906112 3:73767062-73767084 AAAGACTTGGCGAAGGAGGGTGG - Intergenic
958024767 3:88037853-88037875 AAAGCCTTCCTTCTGGAGGATGG - Intergenic
958919260 3:100085329-100085351 AATGAATTCCTTAAGGAGAAGGG - Intronic
959210652 3:103375744-103375766 AAACACTTTTTGAAGGAGGGTGG + Intergenic
959518353 3:107296792-107296814 AAATAATTACTGAAAGAGGAAGG + Intergenic
959551619 3:107665983-107666005 AAAGACTACATGAAGGTGCAAGG - Intronic
960738892 3:120811083-120811105 TAAGACTCCCTGGAGAAGGAAGG + Intergenic
960956494 3:123035174-123035196 GAAGGCTTCTTGAAGGAGGTGGG + Intergenic
961102455 3:124211903-124211925 GAAGGCTTCCTGGAGGAAGAGGG + Intronic
961151531 3:124642504-124642526 AAAGTCTTGCTGAAGCAGGTAGG - Intronic
961199399 3:125032406-125032428 AGAGGCTTCCTGGAGGGGGAGGG + Intronic
961584616 3:127911623-127911645 AAATACATGATGAAGGAGGATGG + Intergenic
961820213 3:129572032-129572054 GAAGGCTTCCTGGAGGAGGTGGG - Intronic
962782877 3:138737878-138737900 AAACACGTCCTGAAGGGGGAGGG + Exonic
964097972 3:152955458-152955480 AAAGATTTCCAGCAGAAGGAAGG - Intergenic
964924667 3:161940696-161940718 AAAAGCTTCCTGAAGGAAAATGG - Intergenic
965655928 3:170984869-170984891 AAAGACATACTGTGGGAGGATGG - Intergenic
965657527 3:171004373-171004395 AAGGACCTCTTAAAGGAGGACGG + Intronic
965944488 3:174224002-174224024 AAATAGTTCATGAAGCAGGATGG - Intronic
966809471 3:183830505-183830527 AAAGGCTTCCTGGAGGATGTGGG + Intronic
967337898 3:188364613-188364635 GAAGACTTTCTGGAGGAGGAGGG + Intronic
967878594 3:194283044-194283066 GAACACTTGCTGAGGGAGGAAGG + Intergenic
967918310 3:194595977-194595999 AAAGGCTTCCTGGAGGAAGGGGG + Intronic
968312551 3:197696011-197696033 TAAGACTTCCTGAAGAAGCCTGG - Intronic
968323866 3:197795109-197795131 GAAGACTTCTTGAAGCAGAAAGG + Intronic
968730424 4:2266991-2267013 GAAGGCTTCCTGGAGGAGGTGGG + Intergenic
968982072 4:3855675-3855697 TAAGGACTCCTGAAGGAGGAAGG - Intergenic
969576410 4:8038581-8038603 GAAGACTTCGTGGAGGAGGTGGG - Intronic
971219643 4:24693184-24693206 AAACACTGCCTGGAGGAGAATGG - Intergenic
971266075 4:25097063-25097085 AGAGATTCCATGAAGGAGGAAGG - Intergenic
971767528 4:30852622-30852644 GAAAAATCCCTGAAGGAGGAAGG + Intronic
972964020 4:44487140-44487162 AAAGACTACTTGAAGGCGGATGG + Intergenic
974402793 4:61426716-61426738 AAAGACTACTTGAAGGTGGGTGG - Intronic
975006040 4:69287538-69287560 GAACACTGCCTGAAGCAGGAAGG + Intronic
975166432 4:71182945-71182967 GGAGAATTCCTGCAGGAGGAAGG + Intergenic
975499032 4:75064676-75064698 GAAGCCTTCTTGAAGGAGAATGG + Intergenic
976566524 4:86556133-86556155 AAACAATTCCTGAAGAAGGATGG + Intronic
977397970 4:96494784-96494806 AGAGACTTCCCCAAGGAGAAAGG + Intergenic
978069067 4:104443850-104443872 AAAGAATTACTGAAAGAGGGAGG - Intergenic
978854452 4:113378144-113378166 AATGAAATCCTGAAAGAGGATGG + Intronic
979241953 4:118455003-118455025 AAAGACTTCCTGGATGAGGTTGG - Intergenic
979336398 4:119468174-119468196 AAAGACTTGGTGAAGGAGATGGG - Intergenic
979746131 4:124215401-124215423 ACAGACTTACTGATGTAGGAAGG - Intergenic
980107884 4:128605550-128605572 ATGGACTTACTGAAGGGGGACGG - Intergenic
980640460 4:135570711-135570733 GAAGACTCTCTGAAGAAGGACGG + Intergenic
980843752 4:138299358-138299380 AGAGACTTCCTGGAAGAGGCTGG - Intergenic
981081346 4:140642210-140642232 GAAGAATTCCTGAAGGAGAGTGG - Intronic
981906659 4:149928936-149928958 AAAAACTTTCTGTAGGATGAGGG + Intergenic
982232117 4:153218840-153218862 AAAGGCTTCCTGGAGAAGGTAGG - Intronic
983079471 4:163367181-163367203 AAAAAATTGCTAAAGGAGGAGGG + Intergenic
983239305 4:165213516-165213538 AAAGACTTGGTGAAGGAGATGGG - Intronic
983907750 4:173202578-173202600 TAAGATTTCCTGGAGGAGGCAGG - Intronic
983984651 4:174043565-174043587 AAAGACTTCTTGATGGAAGTAGG - Intergenic
984955672 4:185043227-185043249 AAACACTTCCAGCAAGAGGAAGG + Intergenic
985801990 5:2010556-2010578 AACCCCTTCCTGAGGGAGGAAGG - Intergenic
986197003 5:5546463-5546485 AAAGCCATCTTCAAGGAGGAAGG - Intergenic
986392303 5:7298086-7298108 AGAGGCTTCCAGGAGGAGGAGGG + Intergenic
986553910 5:8990986-8991008 ACAGACTTACTGTAGAAGGATGG - Intergenic
986571942 5:9174811-9174833 AGAGACTTTCTGAAGGAGTGAGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987593167 5:19959664-19959686 ACAGATTTCCAGAAGGAGAAGGG + Intronic
988702043 5:33685239-33685261 GAAAACTTCCAGCAGGAGGAAGG + Intronic
989134937 5:38144403-38144425 AAAGACTTTTGGAAGGAGGTGGG - Intergenic
989213515 5:38880573-38880595 AAAGCCTTCATGAAAGAGAAGGG + Intronic
990050668 5:51495399-51495421 GAAGACTTGTTGGAGGAGGATGG - Intergenic
990827442 5:59917102-59917124 AAAGACTTCTTCAAGAAGGATGG - Intronic
993959167 5:94275738-94275760 AAGGACTACCTGAGGGAGCAAGG - Intronic
994382705 5:99090169-99090191 AGACCCTTCCTCAAGGAGGAGGG - Intergenic
998084463 5:139306557-139306579 AAACACTGCCTGATGTAGGATGG + Intronic
999289094 5:150411893-150411915 AAAGAGTTTCTAAAAGAGGATGG - Intronic
999481135 5:151949175-151949197 CAAGACTTCCTGAAGGAGGAAGG + Intergenic
1000863043 5:166479341-166479363 AAAGACTTACTGATGACGGAGGG + Intergenic
1001149606 5:169215715-169215737 AAAGATTTCCTGAATAAAGAAGG + Intronic
1001180017 5:169511830-169511852 TAAAACTTCCTGAAGCAGGAGGG + Intergenic
1002854421 6:1024425-1024447 AAAGACCTCGGGAAGGAAGAAGG - Intergenic
1003358694 6:5402103-5402125 AAAAACAACCAGAAGGAGGATGG - Intronic
1003983280 6:11410025-11410047 AAAGATTTCCTCAAGGAAGCTGG + Intergenic
1005111462 6:22286296-22286318 ACAGAGTTCCTGCAGGATGAGGG + Intergenic
1005687198 6:28266057-28266079 AAGGACTTCTTGAGGGTGGAGGG - Intergenic
1006141914 6:31934391-31934413 GAAGACTTCTTGGAGGAGGTGGG - Intronic
1006153659 6:32002496-32002518 AACGACTTCCTCCAGGAGTATGG + Exonic
1006159967 6:32035233-32035255 AACGACTTCCTCCAGGAGTATGG + Exonic
1006431950 6:34002539-34002561 GAAGGCTTCCTGAAGGAGGTAGG + Intergenic
1006457361 6:34139496-34139518 GCAGGCTTCCTGGAGGAGGAAGG - Intronic
1007050924 6:38828170-38828192 ATAGGCTTCCTGCAGGATGAAGG - Exonic
1007063981 6:38970481-38970503 AATGAGAGCCTGAAGGAGGATGG - Intronic
1007249904 6:40488462-40488484 GAAGGCTTCCTGCAGGAGGGAGG - Intronic
1007269252 6:40623828-40623850 AAAGATATCCTGAGGCAGGATGG - Intergenic
1007271710 6:40642382-40642404 GAAGGCTTCCTGCAAGAGGAGGG + Intergenic
1007384107 6:41509195-41509217 GGAGACTTCCTGGAGGAGGTGGG + Intergenic
1007751985 6:44076489-44076511 AATGATTTCCCGAAGCAGGAAGG - Intergenic
1007755716 6:44097974-44097996 GATGACTTCCTGGGGGAGGAGGG - Intergenic
1007829056 6:44624490-44624512 AATGAGAACCTGAAGGAGGAGGG + Intergenic
1007836883 6:44680903-44680925 GAAGGCTTCCTGAAGGAGGTGGG - Intergenic
1008322139 6:50128976-50128998 AAAGACTTCCTGAAGTTTAATGG + Intergenic
1008595286 6:53035817-53035839 AAGGACCTCATCAAGGAGGAAGG + Intronic
1008675234 6:53812009-53812031 AAAGTCTTCCTGGAGGTAGAGGG + Intronic
1009378807 6:63005173-63005195 AAAGCCTTCCTGATCAAGGAAGG - Intergenic
1009859783 6:69312331-69312353 AAGAACTTCCTTAAGGAGAAAGG + Intronic
1012469355 6:99553594-99553616 GAAGATTTACTGAAGGAGGAAGG - Intronic
1013219546 6:108065935-108065957 AAAGAGTTCATGAAGGAAGCAGG + Intronic
1015525670 6:134173995-134174017 AAAAACTTACTGGAGGAGAAGGG + Exonic
1015616123 6:135077071-135077093 AATGCCTTCCTGAAGGAGTGAGG - Intronic
1017539458 6:155385371-155385393 TAAGACTTCCTGGAGGAGCTAGG - Intergenic
1017859398 6:158381051-158381073 CAAGGCTTCCTGAAGGTGGGTGG + Intronic
1017906173 6:158758787-158758809 AATGGCTTCCTGGAGGAGGTGGG - Intronic
1018348898 6:162934454-162934476 ACAGACTTTCTGAAAGAGAAGGG - Intronic
1018377851 6:163230828-163230850 AAAGACTTCCTGGAGGAGAGAGG + Intronic
1018430044 6:163714795-163714817 ACAGAATTCATGAAGGAAGAGGG - Intergenic
1019378194 7:707444-707466 AAAGGCTTGCTGTTGGAGGAAGG + Intronic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1019777251 7:2919192-2919214 AAGGGCTTCCTGGAGGAGGAGGG + Intronic
1020898785 7:13976036-13976058 AAACACTCCCAGAAGGATGATGG - Intronic
1022664244 7:32395361-32395383 AAAGATTTCCAGAAAGATGAGGG + Intergenic
1023344722 7:39259764-39259786 ACAGATTTCCCGAAGGAGCAGGG - Intronic
1023643190 7:42282228-42282250 AAAGACTTTCTGTGGGAGGCAGG - Intergenic
1023677435 7:42645016-42645038 AAGGACTACCAGAAGGAAGAGGG + Intergenic
1024483025 7:49884475-49884497 AAAGTCATCCTGATGGATGAGGG + Intronic
1024791456 7:52969331-52969353 AAAGTCTTCCCTAAGCAGGAAGG - Intergenic
1025121024 7:56302885-56302907 AAAAACTTCATGGAGGAGAAAGG + Intergenic
1026963720 7:74426045-74426067 GATGACTTCCTGGAGGAGGCAGG + Intergenic
1027151008 7:75733636-75733658 CAAGGCTTCCTGGAGGAGGCTGG + Intronic
1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG + Intronic
1027249469 7:76389989-76390011 GAGGGCTTCCTGGAGGAGGAAGG + Exonic
1028693027 7:93675365-93675387 AAAGCCTTACTGAAGGTTGAGGG + Intronic
1028741798 7:94283830-94283852 AAAGGCTTCCTGGAGGAGGCAGG - Intergenic
1028891658 7:95994763-95994785 AAAGTCTTCCTGATAAAGGATGG + Intronic
1029623825 7:101707268-101707290 GAAGGCTTCCTGAAGGAGGTGGG - Intergenic
1032089974 7:128906631-128906653 GAAGACTTTCTCAGGGAGGAAGG + Intronic
1032254146 7:130283800-130283822 AAAAACTTCATGTAAGAGGAGGG + Intronic
1032385178 7:131517729-131517751 AAAGAGTTACGCAAGGAGGAAGG - Intronic
1032390634 7:131553273-131553295 GAAAGCTTCCTGAAGGAGGTGGG - Intronic
1032964582 7:137081063-137081085 AAAGACTTCCTGCACCAGGTGGG + Intergenic
1033284790 7:140031818-140031840 AATGACTTCCAGAAATAGGAGGG + Intronic
1033529229 7:142246093-142246115 GAAGACACTCTGAAGGAGGATGG - Intergenic
1033560837 7:142528901-142528923 GAAGACTTCCCGAAGGCGGAGGG + Intergenic
1034461757 7:151201424-151201446 AAAGAAGTCAAGAAGGAGGATGG - Intronic
1035463582 7:159061706-159061728 AAATACTTGCTGAATGAGTAAGG - Intronic
1035737282 8:1898059-1898081 AAAGACGTCCTGGAGGCTGACGG - Intronic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037173072 8:15916768-15916790 GAAGTCTTCCTGAAAGAGGTAGG + Intergenic
1037680228 8:21091291-21091313 AAAGACTTCCTGGAGGAAGTGGG + Intergenic
1037832399 8:22197194-22197216 AGAGGCTTCCTGGAGGAGGCGGG + Intronic
1038893718 8:31756775-31756797 TAAGAGTTTCTGAAGGAAGAAGG + Intronic
1039361244 8:36879605-36879627 GAAGGCTTCCTGCAGGAGGCAGG + Intronic
1040550286 8:48432187-48432209 ATGGGCTTCCTGGAGGAGGAGGG + Intergenic
1042501098 8:69510175-69510197 AAAGGCTTCCTAAGGTAGGAAGG - Intronic
1043112453 8:76203365-76203387 AAGGACTCAGTGAAGGAGGAAGG - Intergenic
1043815774 8:84799414-84799436 AAAGAAATACTGAAGAAGGAAGG + Intronic
1044549156 8:93493138-93493160 AAAGACTTTATGTAGGAGGTAGG - Intergenic
1045444988 8:102251849-102251871 AAAGACTTACTGAATCAGAAAGG + Intergenic
1046816645 8:118591846-118591868 AAAGACTTCCTAAATGATTAGGG - Intronic
1046889639 8:119408408-119408430 AAAGACTACCAGAGGGAGAAGGG + Intergenic
1047405824 8:124584984-124585006 AGAGACTTCCTTAAGTATGACGG - Intronic
1047607881 8:126492709-126492731 AAAGACTTCCAGAAAGAGATGGG + Intergenic
1048474877 8:134734054-134734076 AACGGCGTCCTGAAGCAGGAGGG - Intergenic
1048822375 8:138391948-138391970 AAACACTGCCTAGAGGAGGATGG + Intronic
1049199707 8:141334087-141334109 AAGGACTTCCTGGAGGAGGAGGG + Intergenic
1049352197 8:142170343-142170365 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1050419947 9:5452725-5452747 AAAGGCTTCCTGGAGGGTGATGG - Intronic
1050499725 9:6283899-6283921 AAAGGCTTCTGTAAGGAGGACGG - Intergenic
1052856051 9:33407250-33407272 GAAGGCTTCCTGAAGGAAGAGGG + Intergenic
1052990111 9:34514158-34514180 GGAGACTTCCTGCAGGATGAAGG - Intronic
1055208070 9:73757462-73757484 AAAGTCTTCCTGAAAGAGCCAGG - Intergenic
1055393675 9:75850387-75850409 AAAGGCTTCACGAAGGAGGAAGG - Intergenic
1055763493 9:79635879-79635901 AAAGACTGACTGATGGATGAAGG + Intronic
1056708933 9:88974902-88974924 AAAGGCCTCCTGACAGAGGAGGG - Intergenic
1057847765 9:98538680-98538702 AAAGAAATCCTGAAGTCGGAGGG - Intronic
1058735980 9:107894539-107894561 AATGACTTCCTGAAGCTGTATGG - Intergenic
1059360070 9:113735275-113735297 TAAGTCTTCCTTAAGAAGGAAGG - Intergenic
1059365192 9:113781388-113781410 GAAGGCTTCCTGAAGGAGGAGGG - Intergenic
1060277598 9:122193741-122193763 AACCAGGTCCTGAAGGAGGAAGG + Intronic
1060736130 9:126067526-126067548 GAGGCCTTCCTGGAGGAGGAGGG - Intergenic
1060759056 9:126233447-126233469 CCAGACTCCCTGAAGAAGGAGGG - Intergenic
1061621712 9:131814884-131814906 GAAGGCTTCCTGGAGGAAGAGGG - Intergenic
1061913148 9:133735366-133735388 GAGGGTTTCCTGAAGGAGGAGGG - Intronic
1062276541 9:135733958-135733980 CTAGACTTCCTGAAGGACTAGGG - Intronic
1062722953 9:138053832-138053854 AAACACAGCCTGCAGGAGGAGGG - Exonic
1062737068 9:138143440-138143462 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1185847318 X:3450010-3450032 AAAGTCTTCATGAATGAGGAGGG + Intergenic
1186174473 X:6910624-6910646 GAAGGCTCCCTGGAGGAGGAAGG + Intergenic
1186896594 X:14009983-14010005 CAACACTTGCTGAAGGAAGAAGG + Intronic
1187224167 X:17359931-17359953 TATGACTTCCAGGAGGAGGATGG + Intergenic
1187568100 X:20473237-20473259 GAAGACTTCATGAAGGAGGTAGG + Intergenic
1187633644 X:21203044-21203066 AAAGACTGGCTGACTGAGGAAGG + Intergenic
1189341448 X:40207561-40207583 AAAGAATTCCTGAGGCAGGATGG + Intergenic
1189478241 X:41373815-41373837 AGAGACTTCCAGTGGGAGGAAGG - Intergenic
1190338619 X:49278811-49278833 AAAGCCTGCATGAAGGAGGAGGG + Intronic
1190358015 X:49624214-49624236 AAAGAGCTCCTGAAGGAAGCTGG - Intergenic
1191915007 X:66192044-66192066 AAACACTAACAGAAGGAGGAAGG + Intronic
1193961721 X:87934069-87934091 AATGACTTTCTGGAAGAGGAGGG - Intergenic
1194377998 X:93159915-93159937 GAAGACTACCTGAAAGGGGAAGG + Intergenic
1195656873 X:107340251-107340273 AAAGACTTCCAGAAGGAGGTGGG + Intergenic
1195676659 X:107511982-107512004 AGAGAATTCCAGAAGGTGGAGGG - Intergenic
1196733223 X:118962407-118962429 AAAGGCTTCCCAGAGGAGGAGGG + Intergenic
1197425311 X:126289755-126289777 AAGTAGTTCCTGAAGGAGGAAGG + Intergenic
1198222370 X:134614095-134614117 GAAGGCTTCCTGGAGGAGGTGGG - Intronic
1198404044 X:136294906-136294928 AGAGATTTCTTGAAGGAGGGCGG - Intergenic
1199145434 X:144360555-144360577 AAAGACTTCCTGAAGGGACAAGG + Intergenic
1199864270 X:151828817-151828839 ACAGATTTCCTGGAGGAGGTGGG - Intergenic
1199991733 X:152991258-152991280 AACTACTTCCTGAAAGATGAGGG - Exonic
1200246039 X:154526332-154526354 AAAAAGTACCTGTAGGAGGAAGG + Intergenic
1200399255 X:156009701-156009723 GAGGGCTTCCTGGAGGAGGAGGG + Intronic
1201453283 Y:14140168-14140190 AAGGCTTTCCTGAAGAAGGATGG + Intergenic
1201479298 Y:14421213-14421235 AAAGAATTCCTTTAGGAAGAGGG - Intergenic
1202345374 Y:23917804-23917826 AATTATTTTCTGAAGGAGGAGGG - Intergenic
1202525396 Y:25752285-25752307 AATTATTTTCTGAAGGAGGAGGG + Intergenic