ID: 917596557

View in Genome Browser
Species Human (GRCh38)
Location 1:176535024-176535046
Sequence AACCAGAGGGAGACTGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 304}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917596550_917596557 17 Left 917596550 1:176534984-176535006 CCTGTGTTCCTTGTGCTCTGGTT 0: 1
1: 0
2: 1
3: 14
4: 252
Right 917596557 1:176535024-176535046 AACCAGAGGGAGACTGTAGAAGG 0: 1
1: 0
2: 1
3: 23
4: 304
917596549_917596557 18 Left 917596549 1:176534983-176535005 CCCTGTGTTCCTTGTGCTCTGGT 0: 1
1: 0
2: 1
3: 23
4: 286
Right 917596557 1:176535024-176535046 AACCAGAGGGAGACTGTAGAAGG 0: 1
1: 0
2: 1
3: 23
4: 304
917596553_917596557 -6 Left 917596553 1:176535007-176535029 CCCATCAGGAATTAGAGAACCAG 0: 1
1: 0
2: 0
3: 7
4: 167
Right 917596557 1:176535024-176535046 AACCAGAGGGAGACTGTAGAAGG 0: 1
1: 0
2: 1
3: 23
4: 304
917596551_917596557 9 Left 917596551 1:176534992-176535014 CCTTGTGCTCTGGTTCCCATCAG 0: 1
1: 0
2: 2
3: 16
4: 239
Right 917596557 1:176535024-176535046 AACCAGAGGGAGACTGTAGAAGG 0: 1
1: 0
2: 1
3: 23
4: 304
917596554_917596557 -7 Left 917596554 1:176535008-176535030 CCATCAGGAATTAGAGAACCAGA 0: 1
1: 0
2: 2
3: 16
4: 210
Right 917596557 1:176535024-176535046 AACCAGAGGGAGACTGTAGAAGG 0: 1
1: 0
2: 1
3: 23
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917596557 Original CRISPR AACCAGAGGGAGACTGTAGA AGG Intronic
900460340 1:2799651-2799673 AACGAATGGGAGACTGAAGATGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901420086 1:9144996-9145018 GACCAGAGGCAGCCTGTACAGGG + Intergenic
901428331 1:9197691-9197713 GAGGAGAGGGAGACTGGAGAGGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903311485 1:22461262-22461284 AACCAGAGGGAGACTGGCTAAGG + Intronic
903536651 1:24071366-24071388 AACCTGAAGGAGACTGTACTGGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904677789 1:32208971-32208993 AGGCAGAGGGAGACTGTGGCAGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904899867 1:33848406-33848428 AATCAGTGGGAGACTGGAGGAGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906967538 1:50473123-50473145 AACCACAGGGAGATAGTAGCAGG + Intronic
907964928 1:59319757-59319779 AGGCAGAGGGAGCCTGTGGAGGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910412902 1:86965215-86965237 AACAAGAGAGAGCCAGTAGATGG - Intronic
910484295 1:87695581-87695603 AAACACAGGTAGACTGTACATGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913210974 1:116582037-116582059 AAGCAAAGGGAGATTGAAGAGGG - Intronic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915342368 1:155183719-155183741 TACCAGAGGGAGACGCTGGAAGG - Intronic
916320666 1:163499733-163499755 CAAGAGAGGGAGACCGTAGAAGG + Intergenic
916689790 1:167179334-167179356 AACCAGTGGAACACAGTAGAAGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917596557 1:176535024-176535046 AACCAGAGGGAGACTGTAGAAGG + Intronic
920940825 1:210480649-210480671 TTCTAGAGGCAGACTGTAGATGG - Intronic
921709474 1:218359072-218359094 AACGAGAGGGAGACAGAGGAAGG + Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922454963 1:225767300-225767322 AACCAGAGGTAACCTTTAGATGG - Intergenic
924087526 1:240468456-240468478 AACCAGAGCGGGGCTGAAGATGG - Intronic
924823960 1:247521316-247521338 AGGGAGAGGGAGACTGGAGAGGG - Intronic
1062902192 10:1154800-1154822 AGGCAGAGGGAGACTGGACAAGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064997614 10:21310390-21310412 AACCAGAGCCAGACAGTAAAGGG - Intergenic
1066704942 10:38167100-38167122 ACCCAGAGTGATACTGTTGATGG + Intergenic
1067455929 10:46419254-46419276 AGCCAGTGGGAGACTCTAGCTGG - Intergenic
1067631271 10:47965385-47965407 AGCCAGTGGGAGACTCTAGCTGG + Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072682711 10:97518152-97518174 ACCCAGATGGGGACAGTAGATGG + Intronic
1073013175 10:100377519-100377541 AACAAGAGGGGGACTGTTGATGG + Intergenic
1074897711 10:117791464-117791486 GGTCAGAGGGAGACTGAAGAAGG - Intergenic
1077603008 11:3586841-3586863 AGACAAAGGGAGACAGTAGATGG + Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078382447 11:10857079-10857101 ATCCAAAAGGAGACTGTGGAAGG - Intronic
1078382480 11:10857322-10857344 AACCGGAAGGAGACTAAAGACGG - Intronic
1078423745 11:11233042-11233064 AAATAGAGGGAGACTGAGGATGG + Intergenic
1079439862 11:20500930-20500952 AACCAGAGTCAGACTGCAAAGGG - Intronic
1080622239 11:33996509-33996531 AACCAGAGGAAGAGTGTAGATGG + Intergenic
1080761351 11:35252384-35252406 AAGCAAAGGAGGACTGTAGATGG + Exonic
1082883887 11:58064449-58064471 CACCTGAGGGACTCTGTAGATGG + Intronic
1083082031 11:60104026-60104048 AAACAGAAGTAGACTGTGGATGG - Intergenic
1084729344 11:71063470-71063492 AACCAGAAGGAGCGGGTAGATGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085930736 11:81080056-81080078 AACCAGAGGGAGGAGGTAGAGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088184103 11:107144246-107144268 CAGCAGTGGGAGACTGTAGAGGG - Intergenic
1088926471 11:114308006-114308028 AACCTCATGGAGATTGTAGACGG - Intronic
1089151377 11:116367011-116367033 GACCAGAGGGTGAGTGTAAAAGG - Intergenic
1089469083 11:118706520-118706542 GGCCAGAGGGAGACAGGAGAGGG - Intergenic
1089526025 11:119097245-119097267 CACCAGAGTGAGACTGAAGATGG - Exonic
1089801023 11:121027509-121027531 AAGTAGAGGAAGTCTGTAGAAGG - Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094642535 12:32289971-32289993 AAACAGAGGGAAGCTGTAAAGGG + Intronic
1096131261 12:49160741-49160763 AACCAGTGGGAACCTCTAGAGGG + Intergenic
1096458500 12:51807301-51807323 GACGGGAGGGAGGCTGTAGATGG - Exonic
1097241785 12:57580634-57580656 AACCAGATGGAGACAGGACAAGG + Intronic
1097601732 12:61701077-61701099 AGCCAGAGGTAAAATGTAGAGGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1100332303 12:93595669-93595691 AACTACAGGAAGACTATAGATGG - Intergenic
1101338213 12:103815760-103815782 AACCACTGGGAGACTTTAAAAGG + Intronic
1102495319 12:113315378-113315400 AACCAGATGCAGACAGTTGAGGG + Exonic
1103374512 12:120445439-120445461 GACCTGAGGGAGACTGGAAAAGG + Intronic
1103922311 12:124405366-124405388 AACCAGAGGGTGAGGGTGGAAGG - Intronic
1106238788 13:27890138-27890160 TACAAGGGGGAGACTGGAGACGG - Intergenic
1107461056 13:40603320-40603342 AACCAGATGGAGACCCTAGTTGG + Intronic
1107737880 13:43417187-43417209 CAACAGAGGGAGACGGGAGACGG + Intronic
1107797238 13:44065226-44065248 AACCATGGGGAGATTGAAGAAGG + Intergenic
1108067469 13:46592968-46592990 GAACAGGTGGAGACTGTAGAGGG - Intronic
1109324607 13:60852571-60852593 AACCAGAGGGAGGCGGTACCTGG - Intergenic
1110520201 13:76466732-76466754 AACCAGATGGAAACAGTAAAGGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115239845 14:31243302-31243324 TACCAGAGGGGGAAGGTAGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116788011 14:49309329-49309351 ATCTGGAGGGAGAGTGTAGAGGG - Intergenic
1118453823 14:65927865-65927887 AAACAGAGGGAGTTTGCAGAGGG + Intergenic
1119004987 14:70916726-70916748 GACCAGGGGGTGACTGTTGAAGG + Intronic
1119076247 14:71642374-71642396 CACCAGAGGTAGACTGTTTACGG - Intronic
1119199017 14:72739483-72739505 AAGGAGAGGGAAACTGTAGGAGG - Intronic
1121829672 14:97039233-97039255 AACAAGATGAAGATTGTAGATGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1124203289 15:27696835-27696857 GACCAGAGTGAGTCTGTAGCTGG - Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127006591 15:54577566-54577588 GTCCAGAGGGAGCCTGGAGAAGG - Intronic
1127289286 15:57555943-57555965 AACCAGGGCGAAGCTGTAGATGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127838385 15:62809081-62809103 TTCCAGAGGGAAGCTGTAGAAGG + Intronic
1128827982 15:70738572-70738594 AGCAAGAGGGAGAAAGTAGAAGG - Intronic
1129285742 15:74523094-74523116 AATCAGAGGGAGACAGTCTATGG + Intergenic
1132725793 16:1337877-1337899 AACCTGAGGTGGACAGTAGAAGG - Intronic
1133215912 16:4292452-4292474 ACCCAGAGGGACACTGGAGATGG - Intergenic
1134322958 16:13180356-13180378 ACCCAGAGGGAGCCTGTCCATGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137439221 16:48483868-48483890 AGAGAGAGGGAGACTGTGGAGGG + Intergenic
1138683675 16:58706037-58706059 AACCATGGGGACACTGTGGAGGG + Intergenic
1139218421 16:65152764-65152786 AACAAGAGAGATACTGTAGTAGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140404817 16:74701833-74701855 AACCAATGGGAGCCTCTAGAGGG + Intergenic
1141216392 16:82028240-82028262 GACCAGAGGAAGGCTGTTGAAGG - Intergenic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1144123402 17:12178743-12178765 AACCAGCCGGAGAGGGTAGAAGG - Intergenic
1144379942 17:14684826-14684848 AAATAGAGGGAGTATGTAGAAGG - Intergenic
1144424978 17:15133251-15133273 AACCAATGGGAAACTCTAGAGGG - Intergenic
1145733441 17:27211288-27211310 AGGCAGAGGGAGACGGGAGAGGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1148118407 17:45192222-45192244 AAACAGGGGGTGACTGGAGAGGG - Intergenic
1148796221 17:50198193-50198215 GACCAGAGGGACCCTATAGAGGG + Exonic
1148842785 17:50509375-50509397 AACCAGAAGAAAGCTGTAGAGGG - Intronic
1151934207 17:77251862-77251884 AACCACAGGGAGAAAATAGACGG - Intergenic
1151989388 17:77564499-77564521 AACCAGACAGTGTCTGTAGAGGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152192644 17:78897829-78897851 ATCCAGAGGGTGACTGTGAAAGG + Intronic
1155813343 18:30268670-30268692 AACCAGACAGAGACTATAGATGG + Intergenic
1156523256 18:37739925-37739947 AAAAAGAGGGGGACTGAAGAAGG - Intergenic
1156585862 18:38430200-38430222 AACCAGAGGGAAATTGTTGCTGG + Intergenic
1159314903 18:66759856-66759878 AAACTGATAGAGACTGTAGAAGG - Intergenic
1159465205 18:68772928-68772950 AACCAGTGTGAGTCTGTAAAAGG + Intronic
1159779859 18:72648462-72648484 AACAAAAGAGAGACTGTATAGGG - Intergenic
1160050865 18:75431851-75431873 GACCAGAGGGAGGCTGTATAAGG - Intergenic
1160405508 18:78643853-78643875 GAGCAGAGGGTGACTGTTGAGGG + Intergenic
1161545125 19:4875868-4875890 GAGGAGAGAGAGACTGTAGACGG + Intergenic
1162405007 19:10468184-10468206 AACCAGAGGGGGGCTGGAGCTGG - Exonic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1164196820 19:22974877-22974899 CAACAGAGGGAGACTGTCTAGGG - Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167781234 19:51600772-51600794 AACCAGAAGGAGACTGGAGGTGG - Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168434233 19:56304655-56304677 AACCAGAGGGAAAGAGCAGAGGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
927086939 2:19681257-19681279 ATCCAGAGGGAGAAAGTAGTTGG - Intergenic
927148933 2:20184858-20184880 GAACAGAGGGACACTGGAGACGG - Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928009654 2:27595107-27595129 CAACAGAGGGAGACCGAAGAAGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
932345398 2:70991991-70992013 AACCAGAGGCAGACAGTGCAGGG + Intronic
932582984 2:73004634-73004656 GACCAGAGGGAGTGTGGAGAGGG + Intronic
934582480 2:95455508-95455530 AACTAGAGGGTGTTTGTAGAGGG - Intergenic
934596970 2:95621206-95621228 AACTAGAGGGTGTTTGTAGAGGG + Intergenic
934842905 2:97641797-97641819 AACTAGAGGGTGTTTGTAGAGGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936254900 2:110903211-110903233 GACCAGAGGGAGAGGGGAGAAGG + Intronic
937328658 2:121007848-121007870 AAGATGAGGGAGACTGGAGAAGG - Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940012743 2:149072176-149072198 AAACATAGGGAGACTGAGGAGGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940786713 2:157989326-157989348 AAGCAAAGGGAGATTCTAGATGG - Intronic
941663178 2:168216250-168216272 AATCAGAGGGAGACAGATGAAGG + Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943752094 2:191520001-191520023 AAACAGAGGGATACTTTAAAAGG + Intergenic
944706650 2:202296072-202296094 AACCACAGGGAGATTCTAGGGGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945668963 2:212779126-212779148 AACCAGAGAGTGACTGGAGTTGG - Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946023773 2:216659607-216659629 AGCCAGAGTGAGACTGTGGCAGG + Intronic
948807922 2:240460910-240460932 AACCAGTGGGAGGCGGTAGGAGG + Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1172393406 20:34581920-34581942 AGGCAGAGGGGGACTGTTGATGG - Intronic
1175691355 20:61068088-61068110 AAAGAAAGGGAGGCTGTAGAGGG - Intergenic
1178776680 21:35558292-35558314 AATCAGGGAGAGACTTTAGAAGG + Intronic
1179519519 21:41932935-41932957 ACCCACAGGGAGACTCCAGATGG + Intronic
1179958929 21:44757597-44757619 AACCATGAGGAGACTGTGGAGGG + Intergenic
1180722552 22:17920296-17920318 AACCAGTGGGGTATTGTAGAAGG - Intronic
1181562224 22:23712217-23712239 CACCACAGGGAGGCTGAAGAGGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184309347 22:43631164-43631186 ATCCAGAGGCAGAATGGAGATGG - Intronic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950286618 3:11750289-11750311 AACCTGAGGGTTACTGTAGAGGG - Intergenic
951413136 3:22389490-22389512 AACAACAAGGAGACTGTAGTTGG - Intergenic
951793713 3:26515481-26515503 CAACAGAGGGAGACGGGAGAGGG - Intergenic
953504668 3:43473320-43473342 ATCCAGGAGGAGAGTGTAGACGG - Intronic
953530153 3:43733303-43733325 AACCATAGGGAGACTGGATGAGG - Intronic
953982280 3:47418778-47418800 AACCCGAGGGAGGCTCTGGAGGG - Exonic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
955212626 3:56955959-56955981 TACCAGAGGGAGACAGTTCAGGG - Intronic
957369740 3:79277831-79277853 AACCAAAAGGAAACTATAGAGGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960129958 3:114045297-114045319 AACCAGTGGGAGGCTGTTGGTGG - Intronic
960662786 3:120079186-120079208 TCCCAGAGGGAGACTGAGGAGGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
963453337 3:145513846-145513868 AACCAGTGGTAGACTGAAGGGGG + Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967984058 3:195082380-195082402 CACCAGAGGGAGAGAGAAGATGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971267104 4:25105503-25105525 AACCAGGGGGAGGCTGAAGGAGG - Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
975070177 4:70125768-70125790 AAGCAGAGGGAGACCTTAGGTGG - Intergenic
975213447 4:71727762-71727784 AAGCAAAGGCAGATTGTAGAAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
977767118 4:100812052-100812074 AACAAGAGGGACACTGAATATGG - Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979521955 4:121677339-121677361 AACCAGACTGAGACTTTATAGGG + Intronic
980645625 4:135638776-135638798 ATCCAGAGCTAGACTGTTGAGGG + Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982166473 4:152617990-152618012 AAACAGAGGCAGACTGGAAAGGG - Intergenic
983264960 4:165499058-165499080 AGCAAGGGGGAGAATGTAGAGGG + Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985793861 5:1947825-1947847 AAAAAAAGAGAGACTGTAGAGGG - Intergenic
986659029 5:10042468-10042490 CAGCAGAGGAGGACTGTAGAGGG + Intergenic
988038053 5:25853142-25853164 AAGCAGCGGGACACTGAAGAAGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990190112 5:53250051-53250073 CAGCTGAGGGAGAGTGTAGAGGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991933941 5:71783381-71783403 AACCAGAGAGAGCTTGGAGAGGG + Intergenic
995686405 5:114777174-114777196 GAGCAGAGGGAGAATTTAGAGGG - Intergenic
998959649 5:147471137-147471159 AACCAAAGGCAAACTGTTGAAGG + Intronic
999125048 5:149240279-149240301 AACCTGAGGGTGACTGTGGATGG - Intronic
1000026645 5:157364315-157364337 ATCCAGAGGCAGACTATTGATGG + Intronic
1000267665 5:159653176-159653198 AACCAGATGTAGACTGGAGATGG - Intergenic
1002435044 5:179226063-179226085 GAGCAGAGGGACACTGAAGAAGG + Intronic
1002759185 6:188795-188817 AACCACAGGGAGACTTGGGAAGG + Intergenic
1003024464 6:2541947-2541969 AACCAGAGGGAGATGGGGGAAGG + Intergenic
1003528474 6:6917993-6918015 AAGCAGAGGGAGAATTTGGAAGG + Intergenic
1003812934 6:9804816-9804838 AACCAGAAGGAACGTGTAGAGGG - Intronic
1004253469 6:14041941-14041963 AAGTAGAGGGAGACTGCATAGGG - Intergenic
1005256602 6:24010282-24010304 AACCAGGGGCAGGCTGTAAAAGG - Intergenic
1006064173 6:31450395-31450417 TACCAGAGGAAGACTGTATAAGG - Intergenic
1006346965 6:33490470-33490492 CACAGGAGGGATACTGTAGAAGG + Intergenic
1007079007 6:39085565-39085587 AAACACAGGGAGACAGGAGATGG - Intronic
1007291883 6:40793693-40793715 AGCCAGAGAGAGACAGTAGTAGG + Intergenic
1007380655 6:41488303-41488325 AGCCAGAAGGAGACTGAGGAGGG - Intergenic
1007949695 6:45860319-45860341 AACCAGAGGGAGACAGAAAGAGG - Intergenic
1008085507 6:47239956-47239978 AACCACAGGGAGATTGTAATTGG - Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009392613 6:63163369-63163391 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1010178816 6:73060305-73060327 AACCAGAGTGAGAATGAAGTTGG - Intronic
1010846768 6:80719457-80719479 AAACAGAGGGACAATATAGAAGG + Intergenic
1011606378 6:89110374-89110396 AACCAGTGGGAAACCTTAGAGGG - Intronic
1012416927 6:99022037-99022059 AGCCAGAGGGCGACCATAGAGGG + Intergenic
1013751705 6:113414693-113414715 CAACAGAGGGAGCCTGGAGATGG + Intergenic
1013793591 6:113860100-113860122 AACAAGAAGGAGGCTGGAGAAGG + Exonic
1015240074 6:131012183-131012205 CAACTGAGGGAGACTCTAGATGG + Intronic
1015958565 6:138623360-138623382 AACCAGACAGACACTGTAGAGGG - Intronic
1018700748 6:166424126-166424148 ATCCAGTGGGAGGATGTAGAAGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020359598 7:7314188-7314210 AGCCAGAGGGAGAATGTAAAAGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1025085026 7:56016557-56016579 AACAAGACAGAGACTTTAGAAGG - Intronic
1025775000 7:64553609-64553631 CATCAGAGGGAGACAGGAGAGGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026099776 7:67375128-67375150 AGACAGAGGGAGAGAGTAGAGGG + Intergenic
1028623217 7:92847053-92847075 ACCCAGAGTGAGAGTGGAGAGGG - Intergenic
1032486595 7:132292271-132292293 AATCAGAGGGAGGCTGGAGGTGG + Intronic
1033185542 7:139224890-139224912 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034610089 7:152358968-152358990 AGACAGAGGGAGACTTCAGAAGG - Intronic
1034652384 7:152701702-152701724 TGCCACAGGGAGACTGAAGAAGG - Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035051316 7:156000519-156000541 ACCGAGAGGGAGTCTGTAGAAGG - Intergenic
1036483142 8:9154867-9154889 AAAGAGAGGGAGACGGGAGAGGG + Intronic
1036661238 8:10710471-10710493 AAGCAGAGGCTGACTGCAGAAGG + Intronic
1037839292 8:22232435-22232457 AAGGGGAGGGAGGCTGTAGAGGG + Intergenic
1037965975 8:23134562-23134584 AAGAAGAGGGAGAATGGAGAAGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041357877 8:57021237-57021259 AAGGAGAGGGAGACGGGAGAGGG - Intergenic
1042157751 8:65863921-65863943 AGCCAGAGGGAGACAATAAAAGG - Intergenic
1042739164 8:72024371-72024393 AACCATAGGTTGACTGGAGAGGG + Intronic
1043859348 8:85297999-85298021 TAGCAGAGGTAGACTGCAGAGGG - Intergenic
1043958713 8:86390694-86390716 GACGAGAGGGAGACGGGAGAGGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045264277 8:100605737-100605759 AACCAGAGGGAAACAGATGATGG - Intronic
1045545143 8:103121986-103122008 AACCAGAGAGAGTGTGGAGAGGG + Intergenic
1046260886 8:111766015-111766037 AACCAGAAGGAGAGTGGAGTGGG - Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047395202 8:124491354-124491376 AAGCAAAGGCAGACTGCAGAAGG - Intronic
1048990773 8:139758925-139758947 AGCCAGGTGGAGACTGTGGAAGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051441827 9:17092771-17092793 AACCACAAGGAGACTGGAAATGG + Intergenic
1052565460 9:30144374-30144396 AAGAACAGGGAGATTGTAGATGG + Intergenic
1053148697 9:35729442-35729464 AGGCAGAGGAAGACTGGAGAGGG + Intronic
1055294567 9:74820953-74820975 AAGCAGAGGGAGATGGTAGAGGG + Intronic
1055935643 9:81602042-81602064 AACTGGAGGGAGACCATAGATGG + Intronic
1056607404 9:88097673-88097695 ACCAAGAGGGACACTGTAGTGGG - Intergenic
1058385059 9:104426679-104426701 AAGCAGAGGGAGACTCAACAGGG + Intergenic
1059750293 9:117241301-117241323 AACCAGATGGATCCTTTAGAAGG - Intronic
1187083342 X:16015032-16015054 AACAAGAGAGAGACTGAGGAGGG + Intergenic
1187821743 X:23295218-23295240 AACCAGAGGCGGAATCTAGATGG - Intergenic
1188095671 X:26018513-26018535 AACCAGTGGGGAACTGTAAATGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189427164 X:40911891-40911913 AACCAGAGTGAGACTCTGAAAGG + Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1192350313 X:70350463-70350485 CAACAGAGGGAGACGGGAGAGGG + Intronic
1197063450 X:122211171-122211193 TTCCAGAGGGAGAAAGTAGAGGG - Intergenic
1197915565 X:131530658-131530680 AACCCTAGGGAGACTTCAGAGGG + Intergenic
1199276439 X:145948983-145949005 AATCTGAGGGAGACTGTAACGGG + Intergenic
1199296961 X:146170301-146170323 AACCTGAGGGAGCTTGTAGGTGG + Intergenic
1199491783 X:148407949-148407971 TATCAAAGGGAGAATGTAGATGG - Intergenic
1199508050 X:148588415-148588437 AACCAGAGGGAAACTGTTTATGG + Intronic
1200735532 Y:6789793-6789815 AACTGTGGGGAGACTGTAGAGGG - Intergenic
1202028601 Y:20551023-20551045 CAACAGAGGGAGACCGAAGAAGG - Intergenic