ID: 917597243

View in Genome Browser
Species Human (GRCh38)
Location 1:176541498-176541520
Sequence AAATCACCCCTAGCATCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917597239_917597243 11 Left 917597239 1:176541464-176541486 CCACTGGCATCCTTGCTAAGATC 0: 1
1: 0
2: 0
3: 12
4: 120
Right 917597243 1:176541498-176541520 AAATCACCCCTAGCATCCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 80
917597240_917597243 1 Left 917597240 1:176541474-176541496 CCTTGCTAAGATCAAAATAATTG 0: 1
1: 0
2: 0
3: 15
4: 256
Right 917597243 1:176541498-176541520 AAATCACCCCTAGCATCCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917597243 Original CRISPR AAATCACCCCTAGCATCCTT GGG Intronic
902617311 1:17630865-17630887 AGATCACCCCGAGCCTCCTCGGG - Intronic
902617336 1:17630970-17630992 AGATCACCCCGAGCATCCCCAGG - Intronic
903176910 1:21586939-21586961 TAATCACCCGTTGCATCCTCTGG + Intergenic
903489235 1:23715337-23715359 ACCTCTCCCCAAGCATCCTTTGG + Intergenic
906944776 1:50286393-50286415 AAAGCAGCCCCAGCATCCTGAGG + Intergenic
908398809 1:63751090-63751112 AACTCATCCTGAGCATCCTTTGG + Intergenic
915117802 1:153611279-153611301 TAACCACCCCTAGCATCCCCAGG + Intronic
916512210 1:165482399-165482421 AAATCCCCTTCAGCATCCTTGGG + Intergenic
917597243 1:176541498-176541520 AAATCACCCCTAGCATCCTTGGG + Intronic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
918161771 1:181907925-181907947 CAATCACTCCTAGCATCCTCTGG + Intergenic
921961612 1:221041050-221041072 ACATCACCACTGGCATTCTTGGG - Intergenic
1063816471 10:9780077-9780099 AAATCACCACTAGAACCCTGGGG - Intergenic
1068572179 10:58642286-58642308 AAAACACCCCCAGCCTCTTTCGG - Intronic
1068928418 10:62563839-62563861 AAATCTCCCTTAACATCATTTGG + Intronic
1069098688 10:64290969-64290991 AGATCCCCCCTATCTTCCTTGGG - Intergenic
1072729210 10:97833760-97833782 AAACAACCCCAAACATCCTTAGG - Intergenic
1073942760 10:108716705-108716727 AAATCACAGCCAGAATCCTTGGG - Intergenic
1074712306 10:116187595-116187617 AAGTCAACCCTTGCATTCTTGGG - Intronic
1078017505 11:7627554-7627576 AAATGACCTCCAGCTTCCTTAGG + Intronic
1081263528 11:40990095-40990117 CAATCACCCTCAGTATCCTTGGG - Intronic
1086105564 11:83143488-83143510 AAATTACTACTAGCATCTTTTGG - Intergenic
1093234195 12:16585984-16586006 AAGTCCCCAATAGCATCCTTAGG + Intronic
1097424826 12:59430441-59430463 ATATCACCCCTGAAATCCTTGGG + Intergenic
1098336829 12:69413032-69413054 CAAACACCCCTAGCACACTTAGG - Intergenic
1104603511 12:130169796-130169818 AATTCTCCACTAGCATCTTTGGG + Intergenic
1111318906 13:86597683-86597705 AAATTACCACTAGGATCCTGTGG - Intergenic
1116437477 14:44911531-44911553 AAATCAAACCTAGCCTGCTTGGG - Intergenic
1119752222 14:77087607-77087629 AAAACATCCCCATCATCCTTAGG + Intergenic
1125512052 15:40297412-40297434 AAGTGAACCCTAGCATCCTCTGG + Intronic
1126375713 15:47995010-47995032 AAAACATTCCTACCATCCTTAGG + Intergenic
1128899755 15:71409559-71409581 AAATCACCTCTTACATCTTTTGG + Intronic
1147552232 17:41451856-41451878 AAATTACCCCTAAAATTCTTTGG + Intergenic
1147707346 17:42435659-42435681 AAATCATCTCTAGCTTACTTAGG - Intergenic
1148864376 17:50620925-50620947 AACTGTCCCCTAGCATCCTGTGG + Intronic
1149201133 17:54187230-54187252 AAATCAACTCAAGCATCCATGGG + Intergenic
1157512262 18:48284838-48284860 ACATCATCCCCAGCCTCCTTTGG + Intronic
1158563888 18:58537884-58537906 AAGTCAGCACGAGCATCCTTGGG + Exonic
1159513801 18:69431607-69431629 AAATCAGCCCTGCCATTCTTGGG - Intronic
1164037296 19:21466288-21466310 AACTCTCCCCCAGCATCCTCAGG - Intronic
927155920 2:20221510-20221532 AAATCATGCCTAGCATTTTTTGG + Intronic
927699605 2:25259445-25259467 AAATAACCCCTAGCTTCTTTGGG + Intronic
933337535 2:80977771-80977793 AAATTAGCCCAAGCATTCTTAGG - Intergenic
940791333 2:158033048-158033070 AAATGACCCCTGGCCTCCTAGGG - Intronic
945425200 2:209692828-209692850 AAAGCACCCCTAGCTTTGTTTGG + Exonic
947399804 2:229720229-229720251 AAATCACCTCCAGCTTACTTGGG - Intergenic
1174337802 20:49875709-49875731 AAATCACCCCTGGCATTTTGAGG + Intronic
1181780881 22:25192284-25192306 AAGTCACCCCTAGAAGCCTAAGG - Intronic
1181830539 22:25557010-25557032 ATATCACCCCTGGCATCTCTGGG - Intergenic
1183551500 22:38489498-38489520 CAATCACCCCAATTATCCTTGGG - Intronic
955029262 3:55200758-55200780 ACATCAGCACCAGCATCCTTTGG + Intergenic
956854167 3:73259566-73259588 AAATCCCTTCTAGCATCCTTTGG + Intergenic
959285664 3:104405754-104405776 CAAACAACCCTAGCATCCCTAGG - Intergenic
960533455 3:118791309-118791331 TAATCTCCTCAAGCATCCTTTGG - Intergenic
965368490 3:167829529-167829551 AAATGACATCAAGCATCCTTGGG - Intergenic
966252466 3:177881712-177881734 AAATAACCCACAACATCCTTTGG + Intergenic
966821103 3:183925241-183925263 TGATCACCCCTGGCATACTTAGG - Intronic
968985885 4:3874044-3874066 AATTCACCCCTTCCATCCTTGGG - Intergenic
970664857 4:18325091-18325113 AAATGGCTCCTAGCTTCCTTTGG + Intergenic
975322918 4:73028367-73028389 AAATCAGTCCCAGCTTCCTTGGG - Intergenic
983925553 4:173397597-173397619 AAATCATTGCTACCATCCTTTGG + Intronic
984930974 4:184846834-184846856 AAATCACTGCTTTCATCCTTGGG - Intergenic
986923113 5:12712382-12712404 AAAGCATCCATAGCATCCTCAGG + Intergenic
987976592 5:25022649-25022671 AATAAACCCCTACCATCCTTAGG + Intergenic
988516020 5:31905425-31905447 AAAGCAACCCCAGCATCCTCAGG - Intronic
992936995 5:81718033-81718055 AAACCACACCTAGCATCCTAAGG - Intronic
997015843 5:129934031-129934053 AAATCATCTCTAGTTTCCTTAGG - Intronic
1016236902 6:141878804-141878826 AAATTACCACTTGCATTCTTGGG - Intergenic
1017698857 6:157047993-157048015 AAATCACCCCCATCTTCCCTAGG - Intronic
1023036668 7:36137175-36137197 AAATAACCCAGAACATCCTTTGG + Intergenic
1028709602 7:93891688-93891710 AAATCAATCCTTCCATCCTTAGG + Intronic
1033591663 7:142813455-142813477 GAATCACCCCCAGCCTCCCTGGG + Intergenic
1034873572 7:154705460-154705482 AAATCACCCCTGGGACCCTGAGG + Intronic
1037139124 8:15498511-15498533 AATTCATCGCTAGGATCCTTGGG - Intronic
1042345787 8:67726375-67726397 AAATAGCCCCTAGCCTTCTTTGG + Intronic
1045840725 8:106577712-106577734 AACTCAGCCCCAGCATCCTGAGG - Intronic
1048171237 8:132108831-132108853 AAATAAACCTTAGCATCCATTGG + Intronic
1048588034 8:135793582-135793604 AACTCACCCCTAACAACCTTGGG + Intergenic
1050154984 9:2657161-2657183 AAGTGACCCCTAGAATCTTTAGG - Exonic
1050351515 9:4744596-4744618 GATTCTCCCCTAGGATCCTTGGG + Intergenic
1050579234 9:7033407-7033429 AAATCACCTCTTGCCTCCTGAGG + Intronic
1051109342 9:13617736-13617758 AGACCAACCCTTGCATCCTTAGG - Intergenic
1051335586 9:16063189-16063211 AAATCACCCCTTAAATGCTTAGG - Intergenic
1060926626 9:127459918-127459940 CAATAACTCATAGCATCCTTTGG + Intronic
1187042686 X:15613481-15613503 AAATAAACAATAGCATCCTTGGG - Intergenic
1192194394 X:69018740-69018762 AAAGCACCCAAAGCAACCTTGGG + Intergenic
1193682461 X:84539582-84539604 AAATTACCTCTACCCTCCTTTGG + Intergenic
1196610714 X:117711546-117711568 AAACCATCCATAGCATCCTTAGG - Intergenic