ID: 917600944

View in Genome Browser
Species Human (GRCh38)
Location 1:176573071-176573093
Sequence GTGCTGAGGCATCCTGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917600934_917600944 15 Left 917600934 1:176573033-176573055 CCAAAGAACCTTGAGAGAGATGG 0: 1
1: 0
2: 3
3: 17
4: 214
Right 917600944 1:176573071-176573093 GTGCTGAGGCATCCTGTTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 128
917600939_917600944 7 Left 917600939 1:176573041-176573063 CCTTGAGAGAGATGGGGTGAGGG 0: 1
1: 0
2: 4
3: 36
4: 425
Right 917600944 1:176573071-176573093 GTGCTGAGGCATCCTGTTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917600944 Original CRISPR GTGCTGAGGCATCCTGTTGT GGG Intronic