ID: 917600944

View in Genome Browser
Species Human (GRCh38)
Location 1:176573071-176573093
Sequence GTGCTGAGGCATCCTGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917600934_917600944 15 Left 917600934 1:176573033-176573055 CCAAAGAACCTTGAGAGAGATGG 0: 1
1: 0
2: 3
3: 17
4: 214
Right 917600944 1:176573071-176573093 GTGCTGAGGCATCCTGTTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 128
917600939_917600944 7 Left 917600939 1:176573041-176573063 CCTTGAGAGAGATGGGGTGAGGG 0: 1
1: 0
2: 4
3: 36
4: 425
Right 917600944 1:176573071-176573093 GTGCTGAGGCATCCTGTTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917600944 Original CRISPR GTGCTGAGGCATCCTGTTGT GGG Intronic
900090075 1:916393-916415 GTGCTGTGGCCTGCTGTCGTGGG + Intergenic
900579518 1:3402176-3402198 GGGATGAGGCATCTTGTTGGGGG + Intronic
905663295 1:39745163-39745185 GTGCTGAGACCTCCTGTCGCTGG + Intronic
907271024 1:53291242-53291264 GTGCTGAGGTATCCTCTTTTAGG - Intronic
917600944 1:176573071-176573093 GTGCTGAGGCATCCTGTTGTGGG + Intronic
923136494 1:231124653-231124675 GTGTTGTGGCCTCCTGTTCTGGG + Intergenic
924625402 1:245693213-245693235 GTGCTGAGCCTCCCTGTGGTGGG - Intronic
1063602705 10:7496949-7496971 GTGCTGTGGACTCTTGTTGTGGG + Intergenic
1065999045 10:31087326-31087348 CTGCTCAGGTATCCTGCTGTGGG + Intergenic
1067533402 10:47091100-47091122 GAGCCGAGGGATCCTGTGGTGGG + Intergenic
1074050499 10:109877046-109877068 GTTGTGAGGCAACCTGTTTTGGG - Intronic
1078922243 11:15841575-15841597 TTGCTGTGGCATCCTGGTGAAGG - Intergenic
1080307147 11:30848995-30849017 TTGCTTAGGAATTCTGTTGTAGG + Intronic
1084641587 11:70429615-70429637 GTGCAGAGGCAGCCTGCTCTCGG + Intronic
1084659629 11:70539199-70539221 GTGCTGTTGCATCCTGGGGTCGG - Intronic
1085829875 11:79888149-79888171 GTGGTGAGGAATTCTGTGGTTGG + Intergenic
1087232572 11:95682781-95682803 GTGCTCAGGCTGCCTGTGGTTGG + Intergenic
1089352940 11:117831712-117831734 GTGCTGACGCATCCAGGAGTGGG - Intronic
1090796479 11:130140006-130140028 GTGCTGTGGCAGCCGGGTGTGGG + Intronic
1091674293 12:2477560-2477582 GAGATGAGGCAGCCTGTTGATGG - Intronic
1092604027 12:10099711-10099733 GGTCTCAGGTATCCTGTTGTAGG - Intronic
1093500992 12:19812081-19812103 TTGCTGAGAAATCCTGATGTGGG - Intergenic
1095923859 12:47558761-47558783 TTGCAGAGGCCTCCTGTTGATGG + Intergenic
1098092233 12:66915990-66916012 GGGCTGAAGCATGCTTTTGTTGG + Intergenic
1101363374 12:104048735-104048757 GTGATCATGCATCCTGTTTTTGG - Intronic
1104568518 12:129904806-129904828 GTGCTTAGGGATCTTGGTGTGGG - Intergenic
1112439794 13:99417292-99417314 GTGCGCAGGCATCCTGTGGCGGG - Intergenic
1113314126 13:109160545-109160567 GTTCAGTGGCATCCTGTGGTTGG - Intronic
1117330282 14:54705644-54705666 ATGCTAAGGCATTCTGTTGAAGG - Intronic
1119684258 14:76618514-76618536 GTTCTGCGGCATCATGTTGTAGG + Intergenic
1121054684 14:90842943-90842965 ATGCTGACGCTTCCTGTTCTAGG + Intergenic
1122047922 14:99036485-99036507 GTCCTGAGGCTTCCTGGTGGAGG + Intergenic
1124553256 15:30701978-30702000 GTGCTCAGGAATCCAGTTGCTGG + Intronic
1124677985 15:31703694-31703716 GTGCTCAGGAATCCAGTTGCTGG - Intronic
1126859834 15:52872883-52872905 CTGCTGAGGCTCACTGTTGTGGG + Intergenic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1129354062 15:74976048-74976070 GTGCACAGGCATCGTGTTGTTGG - Intronic
1131889506 15:96957103-96957125 TTGCAGAGGCTTCCTGCTGTTGG + Intergenic
1132020805 15:98360374-98360396 GTGGGGAGGCATCATGTTGCAGG - Intergenic
1132886690 16:2185306-2185328 GTGCTGAGGAAGCCTTTTGCAGG - Exonic
1138091428 16:54177711-54177733 GAGCTGACGCATCCTGTGGCGGG - Intergenic
1140171774 16:72612180-72612202 GTGCTGTGGCATCAATTTGTTGG - Intergenic
1140707682 16:77645967-77645989 ATTGTGAGTCATCCTGTTGTTGG - Intergenic
1142848726 17:2694292-2694314 GGCCTGAGGCTTCCTGTGGTGGG - Intronic
1147552410 17:41453384-41453406 GAGCTGAGGCTTCATTTTGTAGG + Intergenic
1148121398 17:45214307-45214329 GAGCTGGGGAATCCTGTTGCGGG - Intergenic
1149017107 17:51920726-51920748 GTGCAGAAGCATTCTGTTGTGGG - Intronic
1149533597 17:57415231-57415253 GTGCTGTGGCTTAATGTTGTTGG - Intronic
1152365725 17:79855357-79855379 GTGCTCAGGCATCCTGGCCTGGG - Intergenic
1154103561 18:11499784-11499806 GTGCTTGGGCATCCTGGGGTGGG - Intergenic
1164250837 19:23473519-23473541 GTGTTGAGGACTCCTGATGTAGG - Intergenic
1166745151 19:45138379-45138401 GAGCTCAGGCAGCCTGTTGTTGG + Intronic
925107400 2:1304392-1304414 CGGCTGTGGCATCCTGTTCTTGG + Intronic
928338635 2:30421938-30421960 GAGCTGAGGATGCCTGTTGTGGG - Intergenic
929810465 2:45185184-45185206 GTGCTGAGGCAGTCTTATGTAGG - Intergenic
930774515 2:55159098-55159120 GTGCTGAGGCTTCCTATTTTGGG + Intergenic
934849581 2:97689304-97689326 CTGCTGGGGGCTCCTGTTGTCGG - Intergenic
936114249 2:109689302-109689324 CTGCCCAGGCATGCTGTTGTGGG - Intergenic
942609193 2:177724856-177724878 GTGCTGAGGCTTCCTCTAGATGG - Intronic
944656438 2:201880759-201880781 CTGCTGAGGGATCATGTGGTTGG + Intronic
946305361 2:218853971-218853993 GGGCTGAGTCATCTTGGTGTAGG - Intergenic
947287457 2:228532323-228532345 GTGCTCAGTGATCATGTTGTTGG + Intergenic
948723925 2:239920235-239920257 GTGCTGAGGTATTCTGTTCCTGG - Intronic
1169470578 20:5881764-5881786 GTGGTGGGGCTTCCTTTTGTTGG - Intergenic
1171346257 20:24468932-24468954 GCCCTGAGCCAGCCTGTTGTTGG - Intergenic
1173995822 20:47338024-47338046 GTGCTGAGCCGTCCTCTTCTTGG - Intronic
1175277434 20:57781869-57781891 GTGCTGAGGCTGACTGTTGCCGG + Intergenic
1175700198 20:61131349-61131371 GGGCTGAGGAATCCACTTGTGGG - Intergenic
1175982456 20:62745944-62745966 GCGCTGAGGCATCCTCTGGCCGG + Intronic
1176385108 21:6135206-6135228 GTGCTGAGGGCACCTGCTGTGGG - Intergenic
1177320019 21:19508990-19509012 GTGCTGTGGCTTCTTGTTGCTGG + Intergenic
1177838619 21:26212612-26212634 GGGCTGAGGCAGCCTCTTGGAGG + Intergenic
1177878237 21:26660987-26661009 ATGCTGAGGGATGGTGTTGTGGG + Intergenic
1178347922 21:31847999-31848021 GTTTTGAGGCTTCCTGTTGGCGG - Intergenic
1179709581 21:43205553-43205575 GTGGGGAGGAACCCTGTTGTTGG + Intergenic
1179738365 21:43403046-43403068 GTGCTGAGGGCACCTGCTGTGGG + Intergenic
1179767042 21:43582029-43582051 CTGCTGAGGGGCCCTGTTGTGGG + Intronic
1179939846 21:44630142-44630164 GGGCAGGGGCATCCTGTGGTGGG + Intronic
1180744186 22:18075985-18076007 GTGTTGAGGAATCCATTTGTGGG + Intergenic
1184290004 22:43493529-43493551 GTAGTGAGGCACCCTGTTGGGGG + Intronic
1185066818 22:48636605-48636627 GAGGTGAGGCCTTCTGTTGTGGG + Intronic
959003990 3:100998320-100998342 GTTGTGAGGCATCATGTGGTAGG - Intergenic
961584631 3:127911786-127911808 GTGCTGCGGCAGGCTGTTTTGGG + Intergenic
964677867 3:159303695-159303717 CTGCTCAGGAATCCTCTTGTTGG - Intronic
965729918 3:171760863-171760885 GTGCTGAAGCAACCTCTTGCTGG + Intronic
965817523 3:172652487-172652509 GTGCTGAGGCATTGTGGTTTGGG - Intronic
968531264 4:1093007-1093029 GTGCTGACGCAGCCTGTGGTAGG + Intronic
973043131 4:45498635-45498657 GTGCATAGCCATTCTGTTGTGGG - Intergenic
974939368 4:68446318-68446340 GTGCTGAGGCATACTGTGCTAGG - Intergenic
975195510 4:71518799-71518821 TTGCTGAGCCAGCCTGGTGTGGG + Intronic
976069765 4:81228073-81228095 GAGCTGAGGCCTCATGGTGTTGG + Intergenic
981919380 4:150069955-150069977 TTGGTGAGACATCATGTTGTTGG + Intergenic
982872051 4:160592610-160592632 GCTCTGTGGCATCCTTTTGTTGG - Intergenic
984919159 4:184748810-184748832 GTGCAGAGGGATTCTGTTCTTGG - Intergenic
985477411 5:85954-85976 GAGCTCAGGCATCCTGTGGATGG + Intergenic
985817492 5:2137515-2137537 CTGCTGGGTCATCCTGTGGTTGG + Intergenic
986043096 5:4012080-4012102 GTGCTGAGACCTCCTGTCCTAGG + Intergenic
986493734 5:8320441-8320463 GTGCTGAGGCATAATGATGATGG - Intergenic
989759372 5:44994237-44994259 GTTCTCAGGAATCCTGTAGTAGG - Intergenic
990260176 5:54013753-54013775 GTGCTGAGTCAGCCTGTGGGTGG - Intronic
990863184 5:60351144-60351166 GTGCTGAGGCTTTCTTTTCTAGG - Intronic
993915959 5:93742482-93742504 TAGCTCAGGCATCCAGTTGTGGG + Intronic
1004634579 6:17454437-17454459 GTGATGAGGCATTCTGTCCTCGG + Intronic
1006377354 6:33678859-33678881 GTGCTCAGGCATCTTGGGGTGGG + Intronic
1006752314 6:36386534-36386556 GTGCTGTGGCAGCCTGTGGCTGG - Intronic
1007209455 6:40180590-40180612 GTGCTGAGTCTTCCCGTGGTGGG + Intergenic
1013311871 6:108902037-108902059 ATGCTGATGCATTCTGTTGCTGG + Intronic
1013386624 6:109638245-109638267 GTACTGAGGCCTCCTGTTCTAGG - Intronic
1015381790 6:132578215-132578237 CTCCTGAGGCATCCTGTGGGGGG - Intergenic
1017360513 6:153564075-153564097 GGGATGAGGCCTCCTCTTGTAGG + Intergenic
1019037432 6:169073320-169073342 GAGCTGCAGCCTCCTGTTGTTGG - Intergenic
1019436591 7:1025409-1025431 GTACTGAGCAAGCCTGTTGTGGG + Intronic
1022044879 7:26614662-26614684 AGGCTGAGGCATGCTGTTGGTGG - Intergenic
1024355554 7:48410491-48410513 GTGCTGATGCACCCTGTGCTTGG + Intronic
1028774814 7:94664572-94664594 GAGATGAGGCATCATCTTGTGGG - Exonic
1031824134 7:126541833-126541855 GTGCTAAGGAATTCTGTTATGGG + Intronic
1031966662 7:128032109-128032131 CTGCTGACGCATACTGTTCTGGG + Intronic
1033279508 7:139995748-139995770 GTGCTGTGCCATGCAGTTGTGGG - Intronic
1036679018 8:10857069-10857091 GAGCTGAGGCCTCCTGTGCTTGG - Intergenic
1036703957 8:11032675-11032697 CTCCTGAGCCATCCTGCTGTTGG - Intronic
1037611239 8:20478087-20478109 TTGCTAATGCAGCCTGTTGTAGG + Intergenic
1038046667 8:23771532-23771554 TGCCTGAGGCATCCTGTTTTTGG + Intergenic
1041455089 8:58050620-58050642 CTGATGAGGGATCCTGCTGTTGG - Intronic
1044944830 8:97380291-97380313 TTGCTGAGGCATCCTGTGGAGGG - Intergenic
1045191755 8:99890566-99890588 TTACTGTGGCACCCTGTTGTTGG - Intronic
1047813144 8:128432281-128432303 GGTCTGAGCAATCCTGTTGTGGG + Intergenic
1051123620 9:13778937-13778959 GAGCTCAGGCATCCTGCTGAGGG - Intergenic
1053584543 9:39443123-39443145 GTGAGGAGGCATCATGATGTTGG + Intergenic
1054106123 9:61001869-61001891 GTGAGGAGGCATCATGATGTTGG + Intergenic
1059079908 9:111237632-111237654 GTTCTGAGGTTTCCTGTTCTGGG + Intergenic
1061843656 9:133375411-133375433 GTGCTGTGGCTTCCTGTAGCTGG + Intronic
1061919085 9:133772311-133772333 CTGCTGAGGCCTCCTGTCCTGGG + Intronic
1062213607 9:135377572-135377594 GAGATGAGGCGTCCTGTGGTCGG + Intergenic
1191936669 X:66434424-66434446 ATGCTGAGGCTTACTGTAGTGGG + Intergenic
1192282975 X:69703723-69703745 TTGCTGAGGCATGCTGTTGGTGG + Intronic
1193600404 X:83503458-83503480 GTGCTGAGGCATTGTGTGGCAGG - Intergenic
1197846530 X:130810172-130810194 TTACTGAGGCAGCCTGGTGTTGG - Intronic
1199651509 X:149949379-149949401 GTGCTGATGCATCCAGTGTTAGG + Intergenic
1200427165 Y:3034386-3034408 GTGCTCAGTAATGCTGTTGTTGG + Intergenic
1201417687 Y:13763779-13763801 GTCCTAAGGTATCCTGTTTTGGG + Intergenic