ID: 917601014

View in Genome Browser
Species Human (GRCh38)
Location 1:176573815-176573837
Sequence TATCAAAGCAGATGAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 312}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917601011_917601014 -4 Left 917601011 1:176573796-176573818 CCTGATCCCTAGTAGGTAATATC 0: 1
1: 0
2: 0
3: 2
4: 59
Right 917601014 1:176573815-176573837 TATCAAAGCAGATGAAAAGCTGG 0: 1
1: 0
2: 0
3: 26
4: 312
917601012_917601014 -10 Left 917601012 1:176573802-176573824 CCCTAGTAGGTAATATCAAAGCA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 917601014 1:176573815-176573837 TATCAAAGCAGATGAAAAGCTGG 0: 1
1: 0
2: 0
3: 26
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917601014 Original CRISPR TATCAAAGCAGATGAAAAGC TGG Intronic
900018058 1:168338-168360 TATTAGAGAAGCTGAAAAGCAGG + Intergenic
900048316 1:526934-526956 TATTAGAGAAGCTGAAAAGCAGG + Intergenic
900070541 1:768786-768808 TATTAGAGAAGCTGAAAAGCAGG + Intergenic
900858934 1:5210787-5210809 TAGTAAAGCAGAGGAAAATCTGG - Intergenic
903414108 1:23169583-23169605 TTTTAAAGAAGATGAAAATCGGG - Intronic
905427029 1:37894186-37894208 TACCAAAGCAGATGGCAGGCTGG + Intronic
906120739 1:43388923-43388945 GATGAGAGCAGATGGAAAGCTGG - Intronic
906418556 1:45642707-45642729 TATCAAAGGAAATGAAACTCAGG - Intronic
906521461 1:46469313-46469335 TATAAAAGAAAATGTAAAGCAGG + Intergenic
906998254 1:50821969-50821991 GACCAAAGCAGAAGAAAAGTGGG + Intronic
908160739 1:61406284-61406306 TATGAAACCAGATGCAAAGAAGG + Intronic
908432464 1:64072518-64072540 TGTGAAGGCAAATGAAAAGCAGG + Intronic
909258241 1:73451976-73451998 TATCAAGGCAGAGGAGAAGTAGG - Intergenic
910090048 1:83451478-83451500 TATCAAAGGAGAAGAAGAGAAGG - Intergenic
910205938 1:84748691-84748713 AATTTAAGCTGATGAAAAGCTGG - Intergenic
910633197 1:89378567-89378589 TATCACAGAAGATGAATACCTGG + Exonic
911178115 1:94837764-94837786 TATCAAAACAGATGCAAATAGGG - Exonic
911706357 1:101017933-101017955 TATTTAAGCAAATGAAAAACTGG + Intronic
911793801 1:102052313-102052335 TATCATAGCAGATCAAAAGGGGG + Intergenic
912043511 1:105421611-105421633 TTTCAAAGAAGATGTAAAACTGG + Intergenic
913350832 1:117857038-117857060 TTTCAAAGAAGTTGAAAACCAGG + Intergenic
913507927 1:119535436-119535458 TAATAAAGCACATGAAAAGATGG + Intergenic
914867874 1:151447784-151447806 GATCAAAACACATCAAAAGCTGG - Intronic
914965590 1:152254880-152254902 TACAAAAGCAGATAACAAGCTGG + Intergenic
915007689 1:152655443-152655465 TGTCAGGGCAGATGAGAAGCGGG - Intergenic
915913071 1:159926051-159926073 TAGAAAAGGAGATGAAAGGCAGG - Intergenic
916317384 1:163464985-163465007 CATCAAAGCAGGGGATAAGCAGG - Intergenic
916319062 1:163481984-163482006 TATCAGAGAAGAGGACAAGCTGG - Intergenic
917601014 1:176573815-176573837 TATCAAAGCAGATGAAAAGCTGG + Intronic
917914086 1:179683382-179683404 TATCAAAAGGTATGAAAAGCAGG - Intronic
918084098 1:181230550-181230572 CATAAAAGCAGATGATAAGATGG + Intergenic
918226710 1:182490610-182490632 GACCAAAGTAGATGAAAAGATGG + Intronic
918509770 1:185298590-185298612 TTTCAGAGAAGAAGAAAAGCAGG + Intronic
918598039 1:186316394-186316416 CATCAAAGCAGCTGAGAATCAGG + Intronic
919041068 1:192388901-192388923 AATAAAAGAAGATGAAAAACAGG - Intergenic
919300145 1:195751627-195751649 TATCATAGCAGATGACTATCTGG + Intergenic
920656989 1:207884668-207884690 TATCCATTCAGATGAAAATCTGG + Intronic
921605546 1:217149835-217149857 TATGTAAGCATATGAAAAGATGG + Intergenic
922029665 1:221785813-221785835 TATCACAGAAAATGAAAAGGAGG - Intergenic
922105901 1:222514202-222514224 TATTAGAGAAGCTGAAAAGCAGG + Intergenic
922266240 1:223986813-223986835 TATTAGAGAAGCTGAAAAGCAGG + Intergenic
923339823 1:232997773-232997795 TTTCAGAGCAGAAGAAAAGAGGG - Intronic
924348085 1:243091769-243091791 TATTAGAGAAGCTGAAAAGCAGG + Intergenic
1063098401 10:2928282-2928304 TATGAAAACAGAGGAGAAGCAGG + Intergenic
1063472211 10:6297227-6297249 AATCAAGGCAGATGCATAGCAGG - Intergenic
1063713602 10:8505516-8505538 TCTCAAAGCAGTTGAAATACTGG + Intergenic
1063874254 10:10455880-10455902 TATAAAAGCAGAAGACAAGCAGG - Intergenic
1065344120 10:24732669-24732691 TTTAAAAGCAGCTGAAAGGCTGG - Intergenic
1066728273 10:38413132-38413154 TATTAGAGAAGCTGAAAAGCAGG - Intergenic
1068249988 10:54425997-54426019 TATCAGAGAAGATGATAAACAGG + Intronic
1068330197 10:55555256-55555278 CTTCAAAGCAGATGAAAAAATGG + Intronic
1068752545 10:60611875-60611897 TATCAAAGCAGTGGAGAAGTGGG + Intronic
1069756740 10:70778265-70778287 TAGCACAGCAGCTCAAAAGCTGG - Intronic
1071011273 10:80943603-80943625 TTTCAAAAAACATGAAAAGCTGG - Intergenic
1071511126 10:86263215-86263237 TATTTAAGCAGATAAAATGCAGG - Intronic
1072833384 10:98683900-98683922 TATCAAGACAGAAAAAAAGCAGG + Intronic
1073654906 10:105403546-105403568 TGTCACAGCATATGAAAAGATGG + Intergenic
1076078377 10:127555816-127555838 AATCATAGCCGATGAAAAGCTGG + Intergenic
1076104064 10:127806151-127806173 TTTCAAAGCAGATGGAAAGAAGG + Intergenic
1076974660 11:163534-163556 TATTAGAGAAGCTGAAAAGCAGG + Intergenic
1078672913 11:13380891-13380913 TACAAAAACAGATGACAAGCTGG - Intronic
1078948123 11:16094825-16094847 TGTCAAAGCAAAAGAAAAGAGGG + Intronic
1080193340 11:29577970-29577992 GATCAAAGCAGATAAAATGTGGG + Intergenic
1081802984 11:45872319-45872341 TAGCAAACTAGATGAAAATCTGG + Intronic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1082694880 11:56350382-56350404 TATAGAAGCAGATCTAAAGCCGG - Intergenic
1083518300 11:63282170-63282192 TATGAAAGCAGATTAAAAAAAGG - Intronic
1084570018 11:69953719-69953741 TAAGAAGGCAGATGAAAATCGGG + Intergenic
1084907563 11:72359981-72360003 TATAACAGCAGAAGAAAACCAGG - Intronic
1086506557 11:87510614-87510636 TCTGACAGCAGATGAAAAGTGGG - Intergenic
1087655723 11:100920526-100920548 TACAAAAGCAGATGGAAAGAAGG - Intronic
1087927997 11:103942579-103942601 TCTCAAGGCAGAGGAAAAGAAGG - Intronic
1088064026 11:105693806-105693828 TAGAAAAACAGATGAAAGGCTGG - Intronic
1089441435 11:118520937-118520959 AATCAAAGCAGACCAAATGCTGG + Intronic
1089727614 11:120496382-120496404 TACCAAGGCAGATTAAATGCAGG + Intergenic
1092458301 12:8664582-8664604 CAAAAAAGCAGATGCAAAGCAGG + Intergenic
1092581045 12:9841860-9841882 TCTCTAATGAGATGAAAAGCTGG + Exonic
1092801979 12:12177437-12177459 AATCAAGGGAGATGAAAAGCTGG + Intronic
1092997462 12:13963599-13963621 TTTTACAGCAGAGGAAAAGCTGG + Intronic
1093952033 12:25173602-25173624 TATCTAACCAGAGGAAAAGAAGG + Intronic
1094476729 12:30846209-30846231 CCTCACAGCAGCTGAAAAGCAGG + Intergenic
1096239400 12:49951590-49951612 CCTCAAAGCAGAAGAAATGCTGG - Intronic
1097969834 12:65621433-65621455 TTTAAAAGCAAATGAAAAGAAGG - Intergenic
1098116909 12:67188649-67188671 GTTCAATGCAAATGAAAAGCAGG - Intergenic
1098313021 12:69166216-69166238 TAAGAAAGAAGAAGAAAAGCGGG - Intergenic
1100451207 12:94708356-94708378 TTGCAAGGCAGATAAAAAGCTGG + Intergenic
1101554914 12:105799975-105799997 TAACAAAGCAGATGAAATCTTGG + Intergenic
1102129017 12:110510411-110510433 TATCAAAGCAAATCTAAGGCCGG - Intronic
1103028236 12:117591577-117591599 CAGCAAAGCAGATGAAGGGCTGG + Intronic
1103046092 12:117735825-117735847 TATCTTAGAAGATGAAATGCAGG - Intronic
1104227770 12:126852604-126852626 GATGAAAGGAGATGAAAACCTGG + Intergenic
1104412592 12:128571868-128571890 TATCTAAGAAGATGAAGACCTGG - Intronic
1105998232 13:25693514-25693536 TATCTGAGCAGATGAAGGGCAGG + Intronic
1106296393 13:28417925-28417947 AATTAAAGGAGATGAAAAGGAGG - Intronic
1106790149 13:33146862-33146884 TTTCAAAGCTCCTGAAAAGCTGG - Intronic
1107671467 13:42750491-42750513 AACCAAAGCTGATGAAAAGAAGG - Intergenic
1108695549 13:52899600-52899622 AATCAAAGCTGATGAAAATCAGG - Intergenic
1109586939 13:64417550-64417572 TATTAAAGGAGAAGAAATGCTGG - Intergenic
1109975654 13:69828672-69828694 TATCCAGGCAGCTGATAAGCAGG - Intronic
1110371790 13:74748609-74748631 AATAACAGCAGATAAAAAGCAGG - Intergenic
1110797270 13:79653924-79653946 TATCAATGGAGATGAAAAATAGG - Intergenic
1111538655 13:89640164-89640186 TATCAGAGCAGATTAAATGATGG + Intergenic
1111726019 13:92010182-92010204 TATTGAAGCAGATGTAAAACAGG - Intronic
1112527994 13:100171074-100171096 TATCACAGCAGATTGAATGCAGG + Intronic
1112693481 13:101920471-101920493 TCTCACAGCAGTTGAAAAGGAGG - Intronic
1112965740 13:105190957-105190979 AATCATAACAGAAGAAAAGCAGG - Intergenic
1112980676 13:105381059-105381081 TATTACAGAAGATGAAAAGAAGG - Intergenic
1113527942 13:110995882-110995904 ATGCAAAGCAGAAGAAAAGCAGG + Intergenic
1114764399 14:25354428-25354450 TTTCAACTCAGATTAAAAGCTGG - Intergenic
1116478419 14:45368045-45368067 TTTAAAAGCAGATGACATGCTGG + Intergenic
1116669127 14:47818093-47818115 TATGAAAGTAGAAGAACAGCAGG - Intergenic
1116750868 14:48881907-48881929 TTTCAAAGAAAATGAACAGCAGG + Intergenic
1117869458 14:60185075-60185097 TATCAAAGCAGATTAAATTGTGG + Intergenic
1117879964 14:60303604-60303626 AAGCAAAGGAGATAAAAAGCAGG - Intergenic
1117990849 14:61431877-61431899 AATTAAAGAAGATGCAAAGCAGG - Intronic
1118070686 14:62243974-62243996 TAACAAAGAAGATGAAAGGATGG + Intergenic
1118326227 14:64783117-64783139 CATCTATGCAGATGAAAACCAGG - Intronic
1119050416 14:71362410-71362432 TGTTAAAGCAGATGGAAGGCTGG + Intronic
1119395289 14:74321798-74321820 TAAAAATGCAAATGAAAAGCTGG - Intronic
1120197877 14:81506086-81506108 CTACAAAGCAGATGAAAAGTGGG - Exonic
1121255925 14:92530403-92530425 AATCAAGGCAAATAAAAAGCAGG + Intronic
1121776834 14:96596907-96596929 TCTCAATGTAGATGAAAAGGTGG + Intergenic
1122018464 14:98817113-98817135 TGTCAAAACAGACGGAAAGCAGG - Intergenic
1122039596 14:98974988-98975010 AATGATAGCAGATGAAAACCTGG + Intergenic
1124387664 15:29223825-29223847 TATCCCAGCAGACGAAAAGCAGG + Intronic
1126362256 15:47858666-47858688 TCTGAAGGCAGCTGAAAAGCCGG + Intergenic
1126837507 15:52681670-52681692 AAGCAAATCAGATGAAAAGAGGG - Intronic
1128140875 15:65300159-65300181 TATCAAAACAGACGTAACGCTGG + Intronic
1129260174 15:74361880-74361902 TGTCAGTGCAGATGAAAAACTGG - Intronic
1130122770 15:81065632-81065654 TATCTATGCATATGAAAAACTGG - Intronic
1130679026 15:85980441-85980463 AATCAAGGCAGAGGCAAAGCAGG + Intergenic
1131235717 15:90695309-90695331 TACCAAAGCAGATAAACAGATGG - Intergenic
1132794413 16:1712384-1712406 CAGCAAAGGAGATGAAAAGTGGG - Intronic
1133977399 16:10609202-10609224 TAGCGTAGCAGATGCAAAGCTGG - Intergenic
1135258646 16:20962446-20962468 TGTCACATCAGGTGAAAAGCTGG + Intronic
1137390051 16:48073869-48073891 TGTGACAGCAGATGAAAAGTGGG - Intergenic
1140027161 16:71301181-71301203 TATCCAACAAGAAGAAAAGCAGG - Intergenic
1142445606 16:90134124-90134146 TATTAGAGAAGCTGAAAAGCAGG - Intergenic
1142461908 17:101347-101369 TATTAGAGAAGCTGAAAAGCAGG + Intergenic
1148246556 17:46034901-46034923 TATCAAAGGAGATGAATGGAGGG + Intronic
1148803401 17:50248645-50248667 TAAGAAAATAGATGAAAAGCTGG - Intergenic
1149111845 17:53042776-53042798 TATAAAAGCAAATGATAAGGTGG - Intergenic
1149391817 17:56199110-56199132 CGTAAAAGCAGATGAAAAGATGG - Intronic
1150033020 17:61760857-61760879 TTTCAAAGAAGTTGAAAAGGAGG + Intronic
1150258001 17:63764393-63764415 AATCAAATGGGATGAAAAGCTGG + Intronic
1150334937 17:64323935-64323957 TCTCAAAGAAAATGCAAAGCAGG + Intronic
1153212852 18:2787129-2787151 TATCACAGTAGATGAAGAGCTGG + Intronic
1154025775 18:10705862-10705884 GAACAAAGCAGATGGAATGCAGG - Intronic
1155311396 18:24527566-24527588 GAGCAAAGCAATTGAAAAGCAGG - Intergenic
1156582051 18:38388989-38389011 TATCAAGAAAAATGAAAAGCTGG + Intergenic
1160651612 19:233715-233737 TATTAGAGAAGCTGAAAAGCAGG + Intergenic
1166904547 19:46098335-46098357 TTACCAAGCAAATGAAAAGCAGG - Intergenic
925780672 2:7378874-7378896 CTTCAAAGCATATGGAAAGCAGG - Intergenic
925800824 2:7598801-7598823 TGTGAAGGCACATGAAAAGCCGG - Intergenic
926293558 2:11550707-11550729 TTTCAAAGCAGACGAGAAGTAGG - Intronic
928463367 2:31496774-31496796 AATCAAAGCAGCTGGGAAGCTGG + Intergenic
929402489 2:41601431-41601453 TTTCAAAACAGCTGAAAAGGAGG - Intergenic
930327710 2:49941308-49941330 TAACAAAGCAGACAAAAATCGGG + Intronic
930790191 2:55317676-55317698 GATCAAAGATCATGAAAAGCTGG - Exonic
931929450 2:67113413-67113435 TATCAATGCAGACCAAAAGGTGG - Intergenic
932066961 2:68573918-68573940 AATAAAAACAGATAAAAAGCCGG + Intronic
932133927 2:69212149-69212171 TATTAAAGAAGAAGAAAAACAGG + Intronic
932874654 2:75438141-75438163 TATGATAGCAGTTCAAAAGCAGG - Intergenic
933158007 2:78995090-78995112 TGTCAAAGCAGCTGAGAAGGAGG - Intergenic
933837580 2:86258280-86258302 TATAAAAACAGATGACAAGCTGG - Intronic
935935494 2:108177939-108177961 TATAAAAAAAGATGGAAAGCAGG - Intergenic
936479556 2:112873073-112873095 AATCAAAGCATAGAAAAAGCGGG + Intergenic
937069395 2:119051145-119051167 GATCAAGGCAGATGGGAAGCAGG - Intergenic
937530420 2:122820692-122820714 GATTAAAGCAGATGAACTGCAGG + Intergenic
937662991 2:124452157-124452179 TTTCCAAGCAGTGGAAAAGCAGG - Intronic
942782986 2:179668307-179668329 TATCAAAGGTGCTGAAAAACAGG + Intronic
942910426 2:181237077-181237099 TATCTAAGCAGATGACAACTGGG + Intergenic
946670913 2:222103302-222103324 AATCATAACAGATGAAAACCTGG + Intergenic
948425294 2:237883444-237883466 TATCAAAGCAGATGGGAAGGAGG + Intronic
1168886565 20:1263548-1263570 TCTCAAGGCAGATCAAAATCTGG - Intronic
1169573183 20:6928353-6928375 TAGCAAAGCAGGAGTAAAGCAGG - Intergenic
1169966483 20:11223427-11223449 TAACAAAGCACATGATAAGGGGG + Intergenic
1170896880 20:20422990-20423012 TTTTAAAACAGATGAACAGCAGG + Intronic
1174536123 20:51252820-51252842 TACCAATGCAGAGGAAAAGGTGG + Intergenic
1174768850 20:53279464-53279486 TATGAAAGCAGATGGCAGGCTGG + Intronic
1177490777 21:21823357-21823379 TATCAAAGCTGATGTCAAGTGGG + Intergenic
1177569088 21:22862967-22862989 TATCACAGCAGGTGATAAGCAGG + Intergenic
1178948713 21:36968320-36968342 TATTAAAGCAGATGAACAAATGG - Intronic
1183244747 22:36685269-36685291 TCTCAGAGCAGATGGAATGCTGG - Intronic
1184113024 22:42406237-42406259 GAGCAAAGCAGATGAAAGGCTGG - Intronic
1184197000 22:42936600-42936622 TATCAAAGCAGAAATAAAGATGG + Intronic
1184794801 22:46725982-46726004 TATCAAAGCTGATTGACAGCAGG - Intronic
1185312685 22:50165241-50165263 TATCCATGAAGATGAAAAACAGG - Intergenic
950954582 3:17038096-17038118 AATTTGAGCAGATGAAAAGCAGG - Intronic
952124896 3:30289257-30289279 TAACAAATCAGTTGAAAAGTAGG - Intergenic
953416707 3:42725097-42725119 TAGCAAAGCAGATAAAAACAAGG + Intronic
955032351 3:55233531-55233553 TGGCAAAGCAGAGGAGAAGCAGG - Intergenic
955816176 3:62845834-62845856 TATCAAAGCACAGGAAATACAGG - Intronic
956886139 3:73562060-73562082 AATCAAACCAGATCAAAAGATGG - Intronic
961128950 3:124447469-124447491 TGTGAAAACAGATGAAAATCAGG - Intronic
962020419 3:131494323-131494345 TATGATTGAAGATGAAAAGCAGG - Intronic
963287246 3:143445012-143445034 GATCACAGCAGAGGAAAACCGGG - Intronic
963635392 3:147788505-147788527 TATGAATGCATATGAAAATCAGG - Intergenic
965365528 3:167794565-167794587 TATCAAAGCTTAAAAAAAGCTGG - Intronic
965440131 3:168702126-168702148 TATCAAAAGAGATGAAAAGTTGG - Intergenic
967538071 3:190630521-190630543 TTTTAAAGCTGATGAAAAACAGG + Intronic
967958743 3:194901239-194901261 TATCCAAGCAGCTGGAGAGCAGG + Intergenic
968010994 3:195275526-195275548 TATCAAAGCACAAGGAAAGCTGG + Exonic
968366220 3:198186254-198186276 TATTAGAGAAGCTGAAAAGCAGG - Intergenic
969947911 4:10803627-10803649 TATCAAAGCAACTGAAATGTGGG + Intergenic
970522918 4:16903588-16903610 TTTCAGAGAAGATGAAAATCTGG - Intergenic
972805207 4:42522896-42522918 TATTAAAGCACTTGGAAAGCAGG + Intronic
974202473 4:58658865-58658887 TTGCAAAACAGATGAACAGCTGG - Intergenic
974959928 4:68685137-68685159 TATCAAGTCAAATGCAAAGCAGG - Intergenic
975488208 4:74958494-74958516 AAGCAAAGAAAATGAAAAGCTGG + Intronic
977105957 4:92884896-92884918 TATCAATGTAGATGATAAGCTGG + Intronic
977407038 4:96612675-96612697 TATCACAGCAGCAGAAAATCTGG - Intergenic
979333698 4:119444602-119444624 TATTAGAGAAGCTGAAAAGCAGG + Intergenic
979355831 4:119704201-119704223 TAACAAAGCAAATTAAAAGAAGG + Intergenic
979408491 4:120344096-120344118 TAACATAGGAGATGAAAAGTTGG + Intergenic
979818143 4:125135765-125135787 TCTCAAAGCAGTTTCAAAGCTGG - Intergenic
981141425 4:141274021-141274043 TAGTAAAGCAGATGAAAACAGGG - Intergenic
981162202 4:141511859-141511881 TTTTACAGCAGATGAAAAGAAGG + Intergenic
981333990 4:143546814-143546836 TATCAAAGCTAATGAGAAGTGGG + Exonic
982232737 4:153223613-153223635 TGACAAAGTAGATAAAAAGCTGG + Intronic
983586214 4:169357719-169357741 TATAAAAACAGATGGCAAGCTGG - Intergenic
983680754 4:170350917-170350939 TATTAAAGGAGATAAAAAGGTGG + Intergenic
984087495 4:175330682-175330704 TATAAAAGAAGAGGAGAAGCAGG - Intergenic
984279154 4:177647272-177647294 CATCAAAACAAATGAAAAGTTGG - Intergenic
984749144 4:183254946-183254968 TATCAAAACATTTGAAAAGCAGG + Intronic
984934587 4:184879156-184879178 TATAATTTCAGATGAAAAGCTGG - Intergenic
986601266 5:9475225-9475247 TTTAAAAGCAGATGTAGAGCAGG - Intronic
987124156 5:14795550-14795572 TGCAAAAGCAGATTAAAAGCTGG + Intronic
987465167 5:18263836-18263858 TATAAAAGCAGGAGATAAGCTGG + Intergenic
987827090 5:23046067-23046089 GATCAAAGCAGATGTAATGGAGG - Intergenic
989541825 5:42627358-42627380 AATCACAGCAAATGAAAACCTGG - Intronic
991021195 5:61981938-61981960 TATCAAAGCAGATATAAAAAAGG + Intergenic
992422026 5:76615962-76615984 TCTCAAAGCAGTTAAACAGCAGG - Exonic
993590761 5:89792317-89792339 TTTCAAAGCAAATGAGAAGCTGG - Intergenic
993742267 5:91555849-91555871 AAACAAAGCAGCTGGAAAGCTGG + Intergenic
994411029 5:99407760-99407782 TTTCAAAGAAGATGTATAGCAGG - Intergenic
994482804 5:100357517-100357539 TTTCAAAGCAGATGTATAGCAGG + Intergenic
994668774 5:102740928-102740950 TATAAAAGCAGATGTAAACCAGG + Intergenic
995490621 5:112687591-112687613 AAACAAAGCACCTGAAAAGCAGG + Intergenic
996490532 5:124089476-124089498 TATATAAACAGATAAAAAGCTGG + Intergenic
996790437 5:127288457-127288479 CATGAGAGCACATGAAAAGCTGG + Intergenic
997269433 5:132524486-132524508 TACTAAAGTATATGAAAAGCCGG - Intergenic
997748655 5:136322766-136322788 TATCAAAGAAGATACAAAGATGG - Intronic
998220336 5:140272933-140272955 TATGCAAGCAGATGAACTGCTGG + Intronic
999613012 5:153391171-153391193 TTTCAAAGCTGATGCAGAGCTGG + Intergenic
1000394598 5:160760636-160760658 TATCCAAGCAGCTGGCAAGCAGG - Intronic
1000641449 5:163707449-163707471 TATCAAAGCGAAGGACAAGCTGG + Intergenic
1000681840 5:164194802-164194824 CATAAAAGCAGATGTAAAGATGG + Intergenic
1001167719 5:169385812-169385834 TATCACAACAGATTGAAAGCAGG - Intergenic
1001452065 5:171834368-171834390 AATAAAAGCAGATGAAAGGTGGG + Intergenic
1002362927 5:178687463-178687485 TATCAAAGTAGAGGGAAATCCGG - Intergenic
1002725445 5:181291479-181291501 TATTAGAGAAGCTGAAAAGCAGG - Intergenic
1003907887 6:10719484-10719506 ACTGAAAGCAGATGAAAAACTGG - Intergenic
1004099576 6:12595028-12595050 GCTCAAAGCAGAAGAAAAGTTGG - Intergenic
1004414173 6:15409630-15409652 TATGATAGCAGATGATAAGCAGG - Intronic
1005134987 6:22557674-22557696 AATTAAAGCAGCTGAAAAGCTGG - Intergenic
1005229122 6:23679963-23679985 AGTCAAATCAGATGAAAAACTGG - Intergenic
1007161873 6:39797919-39797941 TATAAAACAAGATGACAAGCTGG - Intronic
1008469658 6:51869540-51869562 TATTTAAGCAAATGAAAAGAGGG + Intronic
1008676476 6:53824829-53824851 TATCAAAGGAACTGAAAAACTGG - Intronic
1008833224 6:55794661-55794683 TATAAAGGCCAATGAAAAGCAGG - Intronic
1008976961 6:57438355-57438377 TATGAAAGGAAATGAAAAGATGG + Intronic
1009165097 6:60331301-60331323 TATGAAAGGAAATGAAAAGATGG + Intergenic
1011498563 6:87963093-87963115 TAAAAAGGCAGATGAAAAGCTGG + Intergenic
1012261902 6:97097201-97097223 AATCAGAGCAGATGAAAGGAAGG - Intronic
1012354374 6:98295264-98295286 TAAAAAAACAGATGAAAATCAGG - Intergenic
1013719788 6:113010664-113010686 TATCAAAGGTGAAGAAAAACAGG - Intergenic
1015185705 6:130413308-130413330 TATCAAAACAGATGTCAAGTAGG + Intronic
1015233528 6:130944080-130944102 TTTCCAAGCATCTGAAAAGCAGG + Intronic
1015815044 6:137200934-137200956 TATAAAAACAGATGAATACCAGG + Exonic
1016397729 6:143643929-143643951 TATCAAAAAAGATTAGAAGCAGG + Intronic
1016532952 6:145078346-145078368 TATAAAAACAGATGACAAGTTGG + Intergenic
1017235574 6:152114151-152114173 TTTCAACGCAGAAGGAAAGCAGG + Intronic
1017954376 6:159166873-159166895 ACTGAAAGCAGATGAATAGCAGG - Intergenic
1018108204 6:160509130-160509152 TATCAAAGAAAATACAAAGCAGG - Intergenic
1019020378 6:168912967-168912989 TTTCAGAACAGATGAGAAGCCGG - Intergenic
1020086627 7:5313869-5313891 AAACAAAACAGATGAGAAGCTGG + Intronic
1020633469 7:10668998-10669020 TATCCAAGCAATTGAAAAGGCGG - Intergenic
1021913489 7:25409071-25409093 CAGCAAAGCTGATGGAAAGCAGG - Intergenic
1023525114 7:41093993-41094015 CATCAAAGCAGAGATAAAGCTGG - Intergenic
1023659727 7:42459531-42459553 TAGCACAGCAGGTGAGAAGCTGG + Intergenic
1024012291 7:45279381-45279403 GATCTAAGCAAATGAACAGCAGG - Intergenic
1024070345 7:45779080-45779102 TATTAGAGAAGCTGAAAAGCAGG - Intergenic
1026240816 7:68573675-68573697 TATCAAAACAAATAAAAAGCTGG - Intergenic
1027306898 7:76907925-76907947 TATCAAAGGAGAAGAAGAGAAGG - Intergenic
1028089217 7:86676851-86676873 TATAATAGCAGATGAAAAGATGG - Intronic
1029331937 7:99864499-99864521 TAACAAAGCAGAAGAATAACTGG - Intronic
1029379017 7:100200488-100200510 GGTCAAAGCAGCTGAGAAGCTGG - Exonic
1032047751 7:128623381-128623403 TATTAGAGAAGCTGAAAAGCAGG - Intergenic
1036507446 8:9368429-9368451 AAGCAAAGCAGATGTGAAGCTGG + Intergenic
1036828747 8:12002774-12002796 TTTCAAAGCTGATAAAAAGATGG - Intergenic
1038357371 8:26841744-26841766 TATCAAAGCTGATGCAGAGTTGG - Intronic
1039851536 8:41370394-41370416 TCTCAGAGCATATGAAAAGATGG + Intergenic
1042003502 8:64154363-64154385 TAGCAAAGCATATGTTAAGCAGG + Intergenic
1043118546 8:76291031-76291053 TAGCAAAGCAAAGTAAAAGCGGG - Intergenic
1043277217 8:78413983-78414005 CTTCAAAGTAGAGGAAAAGCAGG - Intergenic
1043737073 8:83761901-83761923 AATCAGGGCAGATGAAAATCAGG - Intergenic
1044455324 8:92386340-92386362 AAACAAAGCAGGTGAGAAGCTGG - Intergenic
1045524515 8:102930272-102930294 TCACAAAGCAGAAGAAAAGAAGG - Intronic
1045756475 8:105549412-105549434 TATCAATGCAAATGAAAAGATGG + Intronic
1046011090 8:108548322-108548344 GATCAAAGTAAATGAAAACCAGG + Intergenic
1046272984 8:111920015-111920037 GAACAATGTAGATGAAAAGCAGG + Intergenic
1047461487 8:125069886-125069908 CATGAAAGCAGATTAAAATCAGG - Intronic
1047897160 8:129379367-129379389 CCTCAGAGAAGATGAAAAGCAGG - Intergenic
1048302157 8:133259767-133259789 GAGCAAAGCAGATGCAAACCAGG + Intronic
1048451708 8:134539203-134539225 TTTGAAAGCAGATGGGAAGCTGG + Intronic
1049191881 8:141292819-141292841 TATCAACGCTGATGAAGGGCTGG + Intronic
1049709771 8:144058245-144058267 TGTCAAAGCCGATGACAGGCTGG + Exonic
1049723607 8:144134135-144134157 TATCAAAGCTGTTAAAAAGACGG - Intergenic
1051054932 9:12973690-12973712 TATAAAAGGAGATGAGAACCAGG + Intergenic
1053038156 9:34844455-34844477 TATCAAAACTTATGAAATGCAGG - Intergenic
1054990996 9:71326826-71326848 TAACACAGCAGAGGAGAAGCAGG + Intronic
1055417436 9:76098741-76098763 TATCAAAGAAGAAGGAAAGGTGG + Intronic
1056082106 9:83106311-83106333 TGTCAAAGTAGCTGAAAATCAGG + Intergenic
1056966826 9:91169722-91169744 TGGCAGAGCAGATGAAAAACTGG + Intergenic
1057002937 9:91529588-91529610 TATCACAACAGATTAAATGCAGG + Intergenic
1058013790 9:100007330-100007352 AATCAAAGTGCATGAAAAGCAGG - Intronic
1058273369 9:103005339-103005361 TGTAAAAGCAGATGAAAAGAAGG + Exonic
1058448526 9:105075043-105075065 TATGAAAACAAATGAGAAGCTGG - Intergenic
1059181047 9:112212661-112212683 GATCAAAACACATGAAAAACAGG + Intergenic
1060684767 9:125599128-125599150 TATAAAAGTAGATAAAAAGTAGG - Intronic
1060767737 9:126307672-126307694 TACAAAAGCAGAGGAACAGCGGG + Intergenic
1061645429 9:131997233-131997255 TATCACAGCTGATGAAGATCAGG + Intronic
1062750588 9:138249120-138249142 TATTAGAGAAGCTGAAAAGCAGG - Intergenic
1186871025 X:13772934-13772956 TATCAAAGCAAAGGAAGAACAGG - Exonic
1187011371 X:15283720-15283742 TCTAAAAGCAGAAGAGAAGCTGG + Intronic
1187430265 X:19217086-19217108 TTTAAAAGCAAATAAAAAGCAGG - Intergenic
1187657925 X:21500923-21500945 TAGCAAAGCAAATTAAAAGATGG - Intronic
1187811362 X:23181032-23181054 TATTAAAGCATAGGGAAAGCTGG + Intergenic
1193032132 X:76909791-76909813 CTTAAAAGCAGATGACAAGCTGG + Intergenic
1193779784 X:85687060-85687082 CATCATAGCAGATGGAAGGCAGG - Intergenic
1194493819 X:94584522-94584544 AAACAAAGCATATGAAAAGGTGG + Intergenic
1194754844 X:97726641-97726663 TATGAAAGCAGATAAATAGGAGG + Intergenic
1194801488 X:98278944-98278966 CATCAAAGAAGATATAAAGCTGG - Intergenic
1195227596 X:102814235-102814257 TAAGAAAGCACATGAAATGCAGG - Intergenic
1195266759 X:103188955-103188977 TGAGAAAGCACATGAAAAGCAGG - Intergenic
1195362417 X:104096117-104096139 TATTTAAGCAGAGGAAAATCAGG + Intergenic
1197005818 X:121496009-121496031 TACCAAATCATATGAAATGCAGG - Intergenic
1199560459 X:149157652-149157674 TATCATACCAGATGTAAATCTGG - Intergenic