ID: 917604388

View in Genome Browser
Species Human (GRCh38)
Location 1:176611680-176611702
Sequence TCCCCAAGAATGCTACAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917604388_917604390 30 Left 917604388 1:176611680-176611702 CCTATCTGTAGCATTCTTGGGGA 0: 1
1: 0
2: 0
3: 6
4: 124
Right 917604390 1:176611733-176611755 GAGTGGCTTATATTATTTCAAGG 0: 1
1: 0
2: 0
3: 19
4: 168
917604388_917604389 13 Left 917604388 1:176611680-176611702 CCTATCTGTAGCATTCTTGGGGA 0: 1
1: 0
2: 0
3: 6
4: 124
Right 917604389 1:176611716-176611738 CTTTATGAGATTAATTTGAGTGG 0: 1
1: 0
2: 0
3: 19
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917604388 Original CRISPR TCCCCAAGAATGCTACAGAT AGG (reversed) Intronic
902963079 1:19978379-19978401 CCCCCAAGGATGCAACGGATCGG - Exonic
904455041 1:30642474-30642496 CCCCCAGGACTGCTACAGAGAGG + Intergenic
904984118 1:34530472-34530494 TCCCCTAGAATTCCCCAGATAGG + Intergenic
906914815 1:49996898-49996920 TTCCCAAGGAGGCTAAAGATAGG - Intronic
909164836 1:72206799-72206821 TCCTAAAGAAGGCTAAAGATGGG + Intronic
915277733 1:154801098-154801120 TCCCCCAGAATCCTAAAGAAAGG - Intronic
915369448 1:155336139-155336161 TCCTCAAGAATGACACAGAAAGG + Exonic
916469902 1:165113053-165113075 TCCCCAACAATGCTAAAAAATGG + Intergenic
917604388 1:176611680-176611702 TCCCCAAGAATGCTACAGATAGG - Intronic
918474500 1:184908825-184908847 CCCCCAAGGAAGCTACAGATTGG + Intronic
920722570 1:208401361-208401383 TCCACAACAATCCTAGAGATAGG + Intergenic
1071022929 10:81080770-81080792 TCTTCAAGAATGCTAAATATAGG + Intergenic
1074304773 10:112266944-112266966 TTCACAAGAATGCCACAAATTGG + Intergenic
1075688778 10:124381506-124381528 GCCCCAGCAATGCCACAGATGGG + Intergenic
1077712035 11:4546939-4546961 TCGGCAGGAATCCTACAGATGGG - Intergenic
1079518518 11:21297092-21297114 TCCCACAGAATGCTGCAGATAGG - Intronic
1080780454 11:35424314-35424336 TCCTGCAGAATGCTTCAGATTGG + Intergenic
1081520634 11:43877872-43877894 TCCCTAGGAATGAAACAGATGGG - Intergenic
1086269598 11:85045395-85045417 TCCCTAAGAAACCAACAGATGGG + Intronic
1087324068 11:96699579-96699601 TCCCTAAGAATGAAACAGGTGGG - Intergenic
1090694304 11:129221993-129222015 ACCCAAAGAATCCTGCAGATAGG + Intronic
1092436727 12:8453449-8453471 TCCCCAAGACTGCTTCAGGATGG - Intergenic
1092929868 12:13305706-13305728 AACCAAAGAATGCAACAGATTGG + Intergenic
1098440096 12:70508588-70508610 TCCCCAAGAATTCAAAAGCTAGG - Intergenic
1102941957 12:116950854-116950876 TACCCACGGATGCTACAGTTTGG + Intronic
1112748834 13:102559729-102559751 CCCCCAAGTATGCTACTTATTGG - Intergenic
1113336018 13:109376633-109376655 TGCACACGAATGCTACAGGTAGG + Intergenic
1116227001 14:42165376-42165398 TCCCTAAGAAAGAAACAGATGGG - Intergenic
1117321538 14:54628550-54628572 TCCCCAAGAATGCTTCCTAGGGG + Intronic
1117824752 14:59689646-59689668 TCTCTAAGAATGCTAAAAATAGG - Intronic
1121714058 14:96060133-96060155 TCCTCAGGAATGCTACAAAAGGG - Intronic
1128321669 15:66699004-66699026 TCCCCAGGAACTCTGCAGATTGG + Intergenic
1130829238 15:87582858-87582880 ACCCCAAGAATGCTACCTCTGGG + Intergenic
1133306303 16:4811830-4811852 AGCCCAAGAATGCCACAGACAGG + Intronic
1133466822 16:6035335-6035357 TCCCCAAGGATGGAGCAGATGGG + Intronic
1137771082 16:51015537-51015559 CCACCAAGAAGGCTAAAGATTGG - Intergenic
1138729405 16:59178164-59178186 TCCCAAAGGGTGCTACAGATAGG + Intergenic
1140768686 16:78183488-78183510 TCCACAACACTGCTACAGAACGG - Intronic
1152239895 17:79155757-79155779 TCCCCAAGAGTGCCACAGCCTGG + Intronic
1153636892 18:7120097-7120119 TTTCCAAGCATGCTAAAGATTGG - Intergenic
1158541176 18:58355978-58356000 TCCCCAAGACAGGTGCAGATCGG + Intronic
1166640681 19:44492690-44492712 GCCCCAAGAATACCTCAGATTGG - Intronic
1166807207 19:45494547-45494569 ACCCCAAGAACCCAACAGATTGG - Exonic
1168660456 19:58161680-58161702 TCCCCAAAAAGGCAACAGACGGG + Intergenic
925636959 2:5949854-5949876 TCCCCAAGAATGCACCTGGTTGG - Intergenic
929421260 2:41792237-41792259 TCCCCACGAAAGCAACAGAGAGG + Intergenic
930788684 2:55300221-55300243 TCCCCCAAAATGCTATTGATTGG + Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
935197800 2:100830047-100830069 TCCCCAGGAAGTCTACTGATAGG - Intronic
936084224 2:109455596-109455618 TCCTCAAGATTTCTTCAGATTGG - Intronic
939313890 2:140521389-140521411 TCCTTAAGAATGCTAAAAATAGG - Intronic
941141343 2:161787222-161787244 TCCTCAAGAAGGCTAAAAATAGG + Intronic
942079230 2:172384880-172384902 TACACAAGAATGGTACAGAGGGG + Intergenic
942308048 2:174627990-174628012 TCCCCAAGAATGCCACTCTTAGG - Intronic
946091761 2:217231964-217231986 TCCCCCAGAGTCCTACAGAGAGG + Intergenic
946879323 2:224161471-224161493 TTCCCAAGAATGATAGAGAGTGG - Intergenic
947148985 2:227095116-227095138 TCCCCAATAATCCTAAAGAATGG - Intronic
1171378766 20:24715623-24715645 TCTCTAAAAATGTTACAGATTGG + Intergenic
1172050967 20:32117640-32117662 CCCCCAAGAATAAAACAGATGGG + Intronic
1172435049 20:34922869-34922891 TGCCAAAGAATGTTACTGATTGG + Intronic
1174287947 20:49485126-49485148 TCTCTAAGGATGCCACAGATGGG + Intergenic
1175369693 20:58479943-58479965 ACCCCCAGAAGGCTGCAGATTGG + Intronic
1177213018 21:18093012-18093034 TCCCAAAGAAGACTACATATAGG + Intronic
1181324194 22:22032324-22032346 TCCCCAAGAAGGATGGAGATGGG - Intergenic
1183238892 22:36640932-36640954 GCCCCAAGAAGGAGACAGATGGG - Intronic
1183308831 22:37098305-37098327 TCCCTGTGAATGCTCCAGATGGG + Intronic
1184806909 22:46800959-46800981 TCCTCCAGAATGCTCCAGGTGGG - Intronic
950608455 3:14107106-14107128 TTCCTAAAAATGCAACAGATAGG + Intergenic
951232182 3:20192031-20192053 TCCCCAAGAGTGCAACTGCTGGG - Intergenic
951278487 3:20718358-20718380 TCCTTAAGAAACCTACAGATTGG + Intergenic
952347311 3:32500892-32500914 GCAGCAAGAATGCTTCAGATGGG + Intronic
952786701 3:37162724-37162746 TCAGAAAGAAAGCTACAGATTGG + Intronic
953716070 3:45318051-45318073 TCTCTAGGAATGCTAGAGATTGG - Intergenic
957141963 3:76371238-76371260 ACCCAAAGAAGGTTACAGATAGG - Intronic
963016928 3:140833234-140833256 ACACAAAGAATGATACAGATGGG + Intergenic
967327784 3:188259357-188259379 TGCCCAAGAATGGTAAAGAGTGG - Intronic
968913717 4:3488144-3488166 TCCCCGGCAATGCTACAGACAGG + Intronic
972199073 4:36691522-36691544 TCCTTAAGAATGCTAAAAATAGG + Intergenic
972213885 4:36872913-36872935 TCCCCAACCATGCTACTGAATGG - Intergenic
973105136 4:46326255-46326277 TCCCCAAGAAAGCTAATGAATGG + Intronic
973129627 4:46634795-46634817 TCTCCAAAAATGCTAAATATAGG + Intergenic
974166644 4:58213072-58213094 TCCCCATTATTGCTATAGATAGG - Intergenic
976120500 4:81775437-81775459 TCCTCAAAAAAGCCACAGATGGG - Intronic
977921289 4:102646170-102646192 ACCCAAAGAATGCTACATATTGG + Intronic
977940516 4:102852741-102852763 TTCCCAAGAATGGTACAGCAAGG + Intronic
979109918 4:116740073-116740095 TACCCAGGAATGGTACAGAAAGG + Intergenic
979937986 4:126721734-126721756 TCCCCAAGAATTCTTAAGGTTGG + Intergenic
980754943 4:137146863-137146885 ACCACAAAAATACTACAGATTGG + Intergenic
981886863 4:149686101-149686123 TCCCCAGGAAAGCCACAAATTGG + Intergenic
983047282 4:163003018-163003040 TCTTCAAGAATGTTACATATTGG + Intergenic
985912936 5:2897270-2897292 TCCCCGAGGATGCTGCACATTGG - Intergenic
991088526 5:62671065-62671087 GCCGTAAGAAGGCTACAGATGGG + Intergenic
992147691 5:73868624-73868646 TCCCCTAGGAGGCAACAGATGGG - Intronic
994017069 5:94979499-94979521 TAGCCAAGAATGCTACTGCTTGG + Intronic
996872321 5:128205000-128205022 TCCCCAAGGAAGATACAGAATGG - Intergenic
997415664 5:133726434-133726456 TCCCCAAAAAGGACACAGATGGG - Intergenic
997776861 5:136616975-136616997 TCCCCAGGACTGACACAGATTGG - Intergenic
999365561 5:151021236-151021258 ACCCCAAGAATGATACAGGCAGG + Intronic
1001415851 5:171544520-171544542 TCCCCAAGACTGCTCCAACTGGG + Intergenic
1004609383 6:17224914-17224936 TCCCCATTATTCCTACAGATAGG - Intergenic
1007600048 6:43075969-43075991 TCCCCCAGAATTCTCCAGGTGGG - Intergenic
1008141149 6:47833811-47833833 TCTCCAAGACTGCTACAAAAGGG + Intergenic
1011390816 6:86851003-86851025 TCTCCAAGAATGCCAGGGATTGG + Intergenic
1012739741 6:103001002-103001024 TCCCCAAGAAAGCTATAAACAGG - Intergenic
1017286480 6:152682340-152682362 TCCCCAAGAATTCGTCTGATTGG + Intergenic
1019871985 7:3772834-3772856 TAACCAAGAATCCTACAGCTAGG - Intronic
1021930805 7:25579421-25579443 GCCCCAAAAATGCTGCAGACTGG + Intergenic
1022784484 7:33624738-33624760 TCCCCCAAAATGTTACAGTTTGG - Intergenic
1027721139 7:81743180-81743202 TCTCCAAAAATGCAAAAGATTGG + Intronic
1028506229 7:91573181-91573203 GCCCCAAGAATGTCACAGAGAGG - Intergenic
1028509114 7:91602922-91602944 TCCTCAGGAGTGCTAGAGATGGG - Intergenic
1029666890 7:102001211-102001233 TCCCCAAGAATGCTCCTGGCAGG - Intronic
1032715380 7:134504906-134504928 ACCCCAAGGATTCTAAAGATGGG - Intergenic
1032950888 7:136910755-136910777 ACCCCAAGAATGATACAGTCAGG - Intronic
1041533888 8:58904169-58904191 TCCCACAGAATGCTTCAGAGTGG + Intronic
1047247094 8:123155497-123155519 TCCCTAAGAATGAAATAGATAGG + Intergenic
1052812299 9:33072434-33072456 TGCCAAAGAAAGCTAAAGATGGG + Intronic
1056489077 9:87087257-87087279 TTCCCAAGACAGCCACAGATAGG + Intergenic
1056956859 9:91089531-91089553 TTCCCCAGAATACTACAGCTTGG + Intergenic
1058404463 9:104656396-104656418 TTCCCAAGAATGGTGTAGATAGG + Intergenic
1185686476 X:1933122-1933144 TCCTCAACAATCCTAAAGATTGG + Intergenic
1188375349 X:29421739-29421761 TCCCCAAAAATGATACAGAATGG + Intronic
1189866093 X:45328860-45328882 TGCCCAAGAATGCAATAGCTAGG + Intergenic
1191228981 X:58079194-58079216 TCCCCTAGAATGCTTTAGGTTGG - Intergenic
1191947945 X:66555707-66555729 TCCTCAAGAATGTTAAATATTGG - Intergenic
1192691088 X:73365487-73365509 TGCTTAAGAATGCTAAAGATAGG + Intergenic
1195577295 X:106466199-106466221 GCTCTAAGATTGCTACAGATGGG - Intergenic
1198168286 X:134079106-134079128 TCCTTAAGAATGCTAAAAATGGG - Intergenic
1199590927 X:149467941-149467963 TCCCCATGAATGCTGCAGCTCGG + Intergenic
1201640646 Y:16172855-16172877 TCCCCAAGAAAGCTATAAACAGG - Intergenic
1201662169 Y:16412471-16412493 TCCCCAAGAAAGCTATAAACAGG + Intergenic