ID: 917605082

View in Genome Browser
Species Human (GRCh38)
Location 1:176619427-176619449
Sequence CCTTCTCAATACCATGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917605082_917605084 5 Left 917605082 1:176619427-176619449 CCTGAAGCATGGTATTGAGAAGG 0: 1
1: 0
2: 3
3: 22
4: 149
Right 917605084 1:176619455-176619477 GAGACTGTAACCTGATTCAGTGG 0: 1
1: 0
2: 1
3: 4
4: 107
917605082_917605085 6 Left 917605082 1:176619427-176619449 CCTGAAGCATGGTATTGAGAAGG 0: 1
1: 0
2: 3
3: 22
4: 149
Right 917605085 1:176619456-176619478 AGACTGTAACCTGATTCAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917605082 Original CRISPR CCTTCTCAATACCATGCTTC AGG (reversed) Intronic
901130651 1:6960969-6960991 ACTTCTCAATATCATACATCTGG + Intronic
903366769 1:22810260-22810282 CCTGCTCAACACCATGCAGCAGG + Intronic
903479686 1:23644253-23644275 CCTTCCAAATGCCATGCCTCTGG + Intergenic
904824319 1:33264754-33264776 CCTGCCCAAGACCATGCATCTGG - Intronic
909863500 1:80637252-80637274 CAAACTCAATTCCATGCTTCAGG + Intergenic
915794006 1:158707251-158707273 ACTTCTTATTACCATTCTTCAGG - Intergenic
916392225 1:164342935-164342957 CCTTGTCTTTTCCATGCTTCTGG - Intergenic
917178554 1:172266615-172266637 TCTTCTAAATACCCTGATTCAGG + Intronic
917216801 1:172687454-172687476 CCTTCTCCATGCCCTCCTTCAGG + Intergenic
917605082 1:176619427-176619449 CCTTCTCAATACCATGCTTCAGG - Intronic
918602470 1:186379568-186379590 TCTTCTCAATACAATGCAGCAGG - Intronic
921240215 1:213172663-213172685 TCTTCTCAATACAATGCTCTTGG - Intronic
921999539 1:221461937-221461959 CCTTCTCTTTAACATTCTTCTGG + Intergenic
922449593 1:225726146-225726168 CCATCTCAATTCCATTCCTCAGG - Intergenic
924838054 1:247675342-247675364 CCTTCTTCATACCCTGCTTTAGG - Intergenic
1063389727 10:5641395-5641417 CCTTTTCAAAACCATGGTTTTGG + Intronic
1065903316 10:30227213-30227235 CTTCCTCACTACCGTGCTTCAGG - Intergenic
1067666233 10:48281543-48281565 CCATATCAATATCAGGCTTCTGG + Intergenic
1073632542 10:105162914-105162936 CCTTCTTAACACAATGCTCCAGG + Intronic
1073836607 10:107451651-107451673 CCTCCTCAATTCATTGCTTCAGG + Intergenic
1077200391 11:1304081-1304103 CCTTCTGAATACGCTGCTTCTGG - Intronic
1081833030 11:46130470-46130492 CCTTCTCAACACAGTGCATCAGG + Intergenic
1084956423 11:72693953-72693975 CCTTCCCATGACCAAGCTTCAGG + Intronic
1086621967 11:88897432-88897454 CCTTCTTAATACCATGTTTTGGG + Intronic
1086842506 11:91705057-91705079 CCTTCTCAATACAATGCTCCAGG - Intergenic
1086943923 11:92826435-92826457 GTTTCTCAATCCCATGCTGCAGG - Intronic
1091712379 12:2751154-2751176 CCTCTTCGATTCCATGCTTCTGG + Intergenic
1092624624 12:10313082-10313104 CCTTCACAATACCATGATTTTGG + Intergenic
1092797556 12:12128013-12128035 CCTTTGCAATGCCAAGCTTCAGG + Intronic
1093774217 12:23053565-23053587 CCTTCTCTCTGCCATACTTCAGG - Intergenic
1099829085 12:87817152-87817174 CCTTCTCAACACCAAGTTTCTGG + Intergenic
1100469832 12:94880551-94880573 CCTTCTCAACACAGGGCTTCAGG - Intergenic
1100850890 12:98709821-98709843 CCTTCTCAATCCTATGTCTCAGG - Intronic
1101068809 12:101051238-101051260 ACTTCTCAACTCCATGCTCCAGG - Intronic
1103663287 12:122539717-122539739 CCTTCTCAATGACAAGATTCTGG - Exonic
1106438698 13:29746219-29746241 CCTTTTCAATCCTCTGCTTCAGG - Intergenic
1106446830 13:29841616-29841638 CCTTCCCAATACCTTGCTCCAGG - Intronic
1108870913 13:54984662-54984684 CCTTCTCCATCTCATGCTTTAGG + Intergenic
1111820520 13:93208116-93208138 CTTTCTCTATACAATGCTCCTGG + Intergenic
1112086678 13:96039423-96039445 CCTTCTTTATACCAAGCTTCTGG + Intronic
1112549358 13:100404971-100404993 CCGACTCAATTCCAAGCTTCGGG - Intronic
1113452045 13:110417555-110417577 CCTTCTCCATAGCATGATTCTGG - Intronic
1114386747 14:22262946-22262968 CCTGCTCTAGAACATGCTTCAGG - Intergenic
1114397413 14:22378383-22378405 CCTCCCCATTACCATGCTTCAGG - Intergenic
1114875025 14:26706201-26706223 ACTTCTTCAGACCATGCTTCTGG - Intergenic
1117069523 14:52043933-52043955 CCTGCTCAACAGCATGCTCCTGG - Intronic
1118266222 14:64297026-64297048 CGTTCTCAATACCAGGCTTCAGG - Intronic
1118386778 14:65262216-65262238 CCTTCTAAATACCATCGTTTTGG + Intergenic
1119539483 14:75428763-75428785 CCTTCTCAATACTCTCCTCCGGG - Intronic
1120836045 14:89039315-89039337 CACTCTCAATACTATGCTTTGGG + Intergenic
1124153229 15:27200997-27201019 CCTTCTCCATGCCCTGCCTCTGG + Intronic
1125093331 15:35821176-35821198 CATTTTCAATGCCTTGCTTCTGG + Intergenic
1130320574 15:82837596-82837618 CCTCATGAATACCAGGCTTCAGG - Intronic
1132345171 15:101103720-101103742 GCTTCCCAACACCTTGCTTCGGG - Intergenic
1133293788 16:4740101-4740123 CATCCTCAAAAACATGCTTCAGG - Intronic
1134308510 16:13055245-13055267 TTTTCCCAAGACCATGCTTCAGG + Intronic
1134563197 16:15228390-15228412 CCTCCTCAATACCATGTTGCAGG + Intergenic
1134923727 16:18140019-18140041 CCTCCTCAATACCATGTTGCAGG + Intergenic
1135340605 16:21644032-21644054 TCTTCTTAATCCCATGCTACTGG + Intronic
1138107163 16:54294081-54294103 TCTTCTCTCTGCCATGCTTCTGG + Intergenic
1138271210 16:55697204-55697226 CCTTCTCAACTCCCTGCTCCTGG - Intronic
1138483247 16:57318199-57318221 CTTTCTCCATACCACCCTTCAGG - Intergenic
1138597673 16:58037781-58037803 CTTTCTCAATACAAGGCTTTGGG - Intronic
1139261041 16:65594080-65594102 ACATCTCAATATCAGGCTTCAGG - Intergenic
1141323474 16:83034219-83034241 CCTTCTCACTGCAATGCTTCTGG + Intronic
1141571002 16:84933620-84933642 CGTACTCAATTCCTTGCTTCAGG + Intergenic
1141704461 16:85657133-85657155 CCTTCTGAATATCTTGGTTCTGG + Intronic
1142603235 17:1067462-1067484 CCTTCACCTTACCAGGCTTCTGG + Intronic
1143716742 17:8777302-8777324 CCTCTTCCCTACCATGCTTCTGG - Intergenic
1145820195 17:27826851-27826873 CCTTGTCCATCCCCTGCTTCAGG + Intronic
1146813383 17:35922619-35922641 CCTTCTGAATAGCAAGCTTCTGG + Exonic
1148558283 17:48591601-48591623 TCTTCTCAATACCATCCCTTTGG + Exonic
1148689962 17:49521421-49521443 CACTCTCAGTCCCATGCTTCAGG - Intergenic
1150785134 17:68156630-68156652 CCTTCTGAATAGCAAGCTTCTGG + Intergenic
1152976782 18:228733-228755 CCTTCTCTATACCAACCCTCAGG + Intronic
1155984350 18:32214128-32214150 CCTGCTCAATACCTTCCTTCTGG - Intronic
1159344868 18:67188522-67188544 CCTCCTCCATACCATCTTTCAGG + Intergenic
1161900872 19:7118070-7118092 CCTTTTCAAAACCATCTTTCAGG - Intronic
1164381192 19:27738306-27738328 CCTTCTCATTACAATGCCTCTGG + Intergenic
1165727111 19:38120773-38120795 ACTTCTCAGCACAATGCTTCAGG - Intronic
1166292243 19:41870551-41870573 ACTCCTCACTACCATGCTTGAGG - Intronic
1167114976 19:47483880-47483902 CCTTCTCAACACCACGTTCCAGG + Intronic
927935398 2:27072964-27072986 CTTTCTAAATATCAAGCTTCTGG - Intergenic
929726253 2:44430823-44430845 CCTACTTAATTCCTTGCTTCTGG - Intronic
932412191 2:71554077-71554099 CCTTGGCAATACCAGGCTTGTGG + Intronic
932516339 2:72354028-72354050 CCTTTTCAAAACCATGTATCAGG + Intronic
934907105 2:98214964-98214986 TCTTGTCAATACCCTGCTTGCGG - Intronic
938080707 2:128368563-128368585 CCTTCTCAACACGCTGCTTCGGG + Intergenic
941844354 2:170118494-170118516 TCTCCTCAATACCATGATGCTGG - Intergenic
942820491 2:180108097-180108119 CCTTCTTAAAAACATTCTTCAGG - Intergenic
944063013 2:195589343-195589365 CCTTCTAAATAACATACTTCAGG - Intronic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
946560459 2:220906524-220906546 CCAGCTCATTACCAGGCTTCAGG + Intergenic
946715368 2:222549285-222549307 CCTGTTCAATAGCATTCTTCAGG + Intronic
947163962 2:227242417-227242439 CTCTCTGAACACCATGCTTCAGG + Intronic
1172578654 20:36029538-36029560 TCTTCTCAACTCCATGCTTGTGG - Intronic
1175661604 20:60817718-60817740 CCTTGACAATAACCTGCTTCAGG + Intergenic
1176970356 21:15258045-15258067 CCCTGTCAATACCATGCTTTCGG - Intergenic
1181452162 22:23030717-23030739 CCTTCAGAATACCATAATTCTGG - Intergenic
1182027439 22:27131556-27131578 CCTTCTTAACACAATGCCTCAGG - Intergenic
949310946 3:2697479-2697501 CCTACTCATTACCATGTTTGTGG + Intronic
955796556 3:62643299-62643321 CCTTCTCAATACAGCACTTCAGG + Intronic
960186820 3:114652291-114652313 TCTTCTGCATACCATGTTTCTGG + Intronic
961322914 3:126090660-126090682 CCTTCAGAATACCATGATTTTGG - Intronic
961655303 3:128438530-128438552 CCTTGTCATTTCCATTCTTCAGG + Intergenic
962979727 3:140476995-140477017 CCTTCTCATTACCTTGCCTCAGG - Intronic
966220468 3:177546141-177546163 CCTGCTCAACACAATGCTTTTGG - Intergenic
966433428 3:179856762-179856784 GCTTCCCAGTACCAGGCTTCTGG + Intronic
968384781 4:125939-125961 CCTTCTCCAACCCAGGCTTCTGG + Intronic
970384471 4:15542528-15542550 TCTTCTCAATACAGTACTTCAGG + Intronic
971131944 4:23821077-23821099 CTTTCTCAACACGATGCTCCTGG + Intronic
971349094 4:25840825-25840847 CCTACTCAACACCATGCTCTAGG + Intronic
972597680 4:40544536-40544558 ACTTCTCAATACCAGCCTTTGGG - Intronic
976269073 4:83212477-83212499 CCTTCTGAATACAAAGCTTCAGG + Intergenic
976890860 4:90045926-90045948 CCTTCTCATTACCAGACTTGAGG + Intergenic
977023051 4:91780055-91780077 CATAGTTAATACCATGCTTCTGG + Intergenic
979476010 4:121157964-121157986 CCTTCTAAATTCAATACTTCTGG + Intronic
983472150 4:168170509-168170531 TCTTCTCCAAACCATGATTCAGG + Intronic
983944129 4:173567364-173567386 CCTGCTCTAGACCATGCTTTGGG + Intergenic
985905532 5:2832496-2832518 CCCTCTGAATAACCTGCTTCAGG - Intergenic
987431389 5:17838403-17838425 ACTTCTTAATACCATGTTTTTGG + Intergenic
987944156 5:24582960-24582982 ACTTTTCAAGACTATGCTTCAGG + Intronic
988523116 5:31963886-31963908 CCTTCTCAATGCCATGATGTAGG + Intronic
988825792 5:34933025-34933047 CTTTCTGAATTCCATGGTTCAGG + Intronic
990605999 5:57410793-57410815 CCTTCTCAAATCCATCTTTCTGG - Intergenic
992553421 5:77880864-77880886 ACATCACAATACAATGCTTCAGG + Intergenic
993025920 5:82646138-82646160 GCTTATCAATAACTTGCTTCAGG - Intergenic
993545969 5:89213221-89213243 TCTTCTCAAAACCATGCTCTAGG + Intergenic
993725636 5:91363416-91363438 CCATCTTAATACTATGCTTTGGG + Intergenic
994020761 5:95022750-95022772 CCTTCTCAATACAGTGCTCTAGG + Intronic
994807346 5:104466552-104466574 CAATGTGAATACCATGCTTCTGG - Intergenic
996544600 5:124664873-124664895 TCTTCTCAATACCATGTTCAAGG + Intronic
1001172867 5:169437814-169437836 CTTCCTCAACACCATGCTTTTGG + Intergenic
1001224621 5:169933119-169933141 CCTTCTCCTTACCCTGTTTCAGG - Intronic
1001797925 5:174517764-174517786 GCTTCTCAATGCCATGCTTCAGG - Intergenic
1003778608 6:9397947-9397969 CTTTCTTAACACCATGCTCCAGG + Intergenic
1005316165 6:24604683-24604705 TCTTCTCAATACCATATTTAAGG + Intronic
1005405342 6:25481491-25481513 CCTTCTCAAGAACATGCCCCTGG + Intronic
1005843760 6:29761969-29761991 TCTTCTCACTCCCATTCTTCAGG - Intergenic
1007048960 6:38806407-38806429 GCTTCTCAGTACCATGCACCAGG + Intronic
1010510188 6:76708805-76708827 CCTTCCCAATACCTTGATTTGGG + Intergenic
1010862256 6:80927249-80927271 CCTTCTCAAATTCATTCTTCAGG + Intergenic
1011402129 6:86975009-86975031 GTTTCTAAATACCATTCTTCAGG - Intronic
1012687693 6:102273141-102273163 CATTCTCAATACCACTTTTCTGG + Intergenic
1015012096 6:128362124-128362146 CATGCTCAGCACCATGCTTCCGG - Intronic
1017405444 6:154114001-154114023 CCTTTTCAACTCCAGGCTTCTGG - Intronic
1019846187 7:3504529-3504551 CCGTCTTAATAGCATTCTTCTGG - Intronic
1020064803 7:5179555-5179577 TCTTCTCAATCCTATCCTTCTGG + Intergenic
1021892340 7:25198041-25198063 TCTTCTCAATATGAGGCTTCAGG + Intergenic
1022849753 7:34248147-34248169 CCTTCTCAACACGGTGCTTGGGG + Intergenic
1023607164 7:41941512-41941534 CCTTCTCAATGCCCTGCACCTGG + Intergenic
1027608046 7:80324673-80324695 TTTTCTCAGTACCAAGCTTCAGG - Intergenic
1029099654 7:98118190-98118212 CATTCTAAATACCATGTTTGTGG + Intronic
1033450506 7:141458450-141458472 CCTTCCAAGTTCCATGCTTCTGG + Intronic
1036935563 8:12998986-12999008 CTTTCTTAATGCCATGTTTCTGG - Intronic
1037990380 8:23317505-23317527 CCTTCTCAACACAGTGCTCCAGG + Intronic
1039525334 8:38209658-38209680 CCTTTTCAAGACCTTGCTTGAGG + Intronic
1042398797 8:68321732-68321754 AATTCTCAAGACCATACTTCAGG - Intronic
1042933358 8:74034657-74034679 TCTTCAGAATACCATGATTCTGG - Intergenic
1043510083 8:80942179-80942201 CCTACACAAAACCATCCTTCTGG + Intergenic
1043649289 8:82568520-82568542 CCTCCTCAAAATTATGCTTCAGG + Intergenic
1043826650 8:84937457-84937479 CCTTCTCCATACCCTGCCACAGG + Intergenic
1044404766 8:91815754-91815776 CTTTCTCAATGCAATGCTTCAGG + Intergenic
1048207514 8:132427096-132427118 CCTTCTCAAGACAGTGCTTAGGG - Intronic
1048475612 8:134739874-134739896 CCTTCTCACTACCAGCCTGCAGG - Intergenic
1049004870 8:139848095-139848117 CCTTCTCCCTACAATGCTTATGG - Intronic
1050303891 9:4286757-4286779 CCTTCTCAATACAGTGCTCTCGG + Intronic
1057534780 9:95890190-95890212 CCTACTCAATACCAAGATGCTGG - Intronic
1059768942 9:117409831-117409853 CCTTCTCCCAACCATTCTTCTGG + Intronic
1061508023 9:131043081-131043103 CCTTCTTAACACCCTGCTTCAGG + Intronic
1190401065 X:50035444-50035466 CCTTCTCACTTCCATTGTTCTGG - Intronic
1190454811 X:50617299-50617321 CCTTCACAATTGTATGCTTCAGG + Intronic
1193538463 X:82741567-82741589 CCTTCAGAATACCATGATTTTGG + Intergenic
1195829848 X:109044910-109044932 CATTCTCAATTTTATGCTTCCGG + Intergenic
1198982738 X:142418036-142418058 TCTTCAGAATACCATGATTCTGG - Intergenic