ID: 917609113

View in Genome Browser
Species Human (GRCh38)
Location 1:176668238-176668260
Sequence TCACCTATATGTATCCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917609113_917609117 24 Left 917609113 1:176668238-176668260 CCTTCAGGGATACATATAGGTGA 0: 1
1: 0
2: 0
3: 7
4: 83
Right 917609117 1:176668285-176668307 GCATGAGGAAAGGTAGATCCTGG 0: 1
1: 0
2: 0
3: 14
4: 206
917609113_917609116 14 Left 917609113 1:176668238-176668260 CCTTCAGGGATACATATAGGTGA 0: 1
1: 0
2: 0
3: 7
4: 83
Right 917609116 1:176668275-176668297 AGCATAGAGAGCATGAGGAAAGG 0: 1
1: 0
2: 2
3: 43
4: 414
917609113_917609115 9 Left 917609113 1:176668238-176668260 CCTTCAGGGATACATATAGGTGA 0: 1
1: 0
2: 0
3: 7
4: 83
Right 917609115 1:176668270-176668292 TCTAGAGCATAGAGAGCATGAGG 0: 1
1: 0
2: 0
3: 20
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917609113 Original CRISPR TCACCTATATGTATCCCTGA AGG (reversed) Intronic
902285850 1:15408380-15408402 TCTCCTGTATGCAGCCCTGAAGG - Intergenic
906120279 1:43385262-43385284 TCACCCAGCTGTCTCCCTGAAGG + Intronic
907642866 1:56209057-56209079 GCACCTATTTGTATCCCTTTTGG - Intergenic
909435157 1:75632350-75632372 TCAGCTATATGTATTTCAGAAGG + Intergenic
913389057 1:118290381-118290403 GCACCCATATGCATCTCTGAAGG + Intergenic
917326731 1:173840947-173840969 AAAGCCATATGTATCCCTGAAGG + Exonic
917609113 1:176668238-176668260 TCACCTATATGTATCCCTGAAGG - Intronic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
918607854 1:186450828-186450850 ACAACTATATGGACCCCTGAGGG - Intronic
919270217 1:195332004-195332026 TCACCTACCTGTACCCATGAAGG - Intergenic
921275812 1:213518834-213518856 TCACATATGTGTATCCATGTGGG + Intergenic
921483078 1:215685840-215685862 TCACCTAAATGTATCTCAGCTGG + Intronic
924888763 1:248250796-248250818 TCACTTAGATGCCTCCCTGAAGG - Intergenic
1065813292 10:29462313-29462335 TCACCAATATGTTTCCCAGCTGG - Exonic
1067136226 10:43609332-43609354 TCACCTGCATGTGTGCCTGATGG - Exonic
1067524679 10:47031129-47031151 TCACCTATCAGAAACCCTGAGGG + Intergenic
1070150322 10:73801177-73801199 TCACCTGCATGTATGCCTGCTGG - Exonic
1079732815 11:23957070-23957092 TAACCTAGGTGTTTCCCTGAAGG + Intergenic
1080743826 11:35089853-35089875 CCACATATTTGTAACCCTGAAGG + Intergenic
1082991933 11:59214208-59214230 TCACCTGTATGCATCCTGGAAGG + Intergenic
1091734018 12:2904340-2904362 TCACCTATATCTATCTGAGATGG + Intronic
1100306079 12:93351486-93351508 TTAACTATAAGTATCCCTTATGG + Intergenic
1107811943 13:44208936-44208958 CCATCTTTATGTCTCCCTGATGG - Intergenic
1108864260 13:54903493-54903515 AGATCTATACGTATCCCTGAGGG + Intergenic
1109381850 13:61572427-61572449 TGAACTATATGAATCCCTGCAGG - Intergenic
1112245566 13:97730271-97730293 GCAACTTTCTGTATCCCTGATGG - Intergenic
1112736358 13:102424301-102424323 TCACTTATATTTTTCCCTCATGG - Intergenic
1115922366 14:38390294-38390316 TCATCTATATGTTTCCTTTATGG - Intergenic
1119012225 14:71005164-71005186 TTACCTATATGTATCTTGGAAGG - Intronic
1120697237 14:87658165-87658187 TCTCCTATTAGAATCCCTGAAGG + Intergenic
1120813825 14:88832165-88832187 AGCCCTAAATGTATCCCTGAAGG + Intronic
1121681409 14:95795633-95795655 TCTTCAATATGTTTCCCTGATGG + Intergenic
1126170032 15:45687526-45687548 TCTCCTGTCTGTATCTCTGATGG - Intronic
1131815929 15:96221288-96221310 GCACCTTTATGTATCTCTCAGGG + Intergenic
1132259241 15:100407460-100407482 TCACCTATGTGCATGCCTGACGG - Intronic
1142475441 17:186123-186145 TCAACTAAAAGTATCCCTTATGG - Intergenic
1144662093 17:17077691-17077713 TTACCTTTTTGTATTCCTGATGG - Intronic
1146773809 17:35594154-35594176 TCAGCTACATGTATGTCTGAAGG - Intronic
1148097904 17:45066615-45066637 ATACCTATATGTATACATGAAGG - Intronic
1149021190 17:51966737-51966759 CCACCTATAAGAATCCCAGAAGG + Intronic
1149600311 17:57889148-57889170 TCATCTGGATGTATCCCTTAGGG + Intronic
1156599774 18:38591435-38591457 TCACTGATTTGTATCCCTCATGG + Intergenic
1160389724 18:78521084-78521106 TGACCTTTCTGTATCCCCGAAGG - Intergenic
1166912879 19:46173265-46173287 TCCCCTATATGGAGCCCAGAAGG + Intergenic
929625794 2:43405270-43405292 ACACATATATGTTTTCCTGAAGG - Intronic
932619209 2:73255966-73255988 GCACTTATATGCATCCCTGCAGG - Exonic
934104792 2:88685781-88685803 TCTCCATCATGTATCCCTGATGG - Intergenic
935952857 2:108346597-108346619 TCACCAAGATGTTTTCCTGATGG - Intergenic
937171006 2:119868745-119868767 TCAACTAAAAGTATCCCTTATGG - Intronic
940088028 2:149883477-149883499 TCACATATGTGTATTCCTGTGGG + Intergenic
945790939 2:214304494-214304516 TCAACTAAAAGTATCCCTTATGG - Intronic
1182848693 22:33452702-33452724 TCTCCTTTATGTACCCCAGATGG - Intronic
949639887 3:6024354-6024376 TCCTCTATATGCATCACTGAAGG + Intergenic
950969816 3:17174983-17175005 TCACCTACATTTATTCCTTAGGG - Intronic
952549265 3:34457296-34457318 GCACCTATATGTACCACTGAGGG - Intergenic
955909437 3:63845121-63845143 TCTCCTTCATGTAGCCCTGAGGG + Intronic
956943989 3:74197882-74197904 TTACCTAAAAGTATCCCTTATGG - Intergenic
957841176 3:85671726-85671748 TCAGCTATGCGTATACCTGAGGG - Intronic
958570020 3:95866709-95866731 TCAACTATATGTTTCCCAAATGG - Intergenic
960203732 3:114869732-114869754 TCACCAATATTTATTCCTGATGG + Intronic
964061849 3:152534736-152534758 TAAACTATATCTAACCCTGAAGG + Intergenic
968396016 4:239251-239273 ACACCTATATGTGCCCCTGTAGG - Intergenic
970101734 4:12531100-12531122 TTACCTATTTGTCTCCCTGATGG + Intergenic
971283037 4:25257537-25257559 TCACCTTTAAGTAAACCTGAGGG + Intronic
973915470 4:55629817-55629839 TTACCTATTTTTTTCCCTGAAGG + Intronic
975410931 4:74048716-74048738 TTTCCTATAGGTTTCCCTGATGG + Intergenic
976929332 4:90545240-90545262 TCACATATATGTATGCATGAGGG - Intronic
978820843 4:112963692-112963714 TAACCTATATTTTTCCCTGAAGG - Intronic
979666619 4:123317701-123317723 TCACATATATCTATTACTGATGG - Exonic
980488920 4:133499390-133499412 TTACTTATCTGTATCCCTGTTGG + Intergenic
981265956 4:142783580-142783602 TCACTTTTATGTATCCCTTGTGG + Intronic
988847528 5:35143596-35143618 TCACCTAAATGTAAACTTGAGGG + Intronic
993326149 5:86539359-86539381 TATCCTATATGTAGCACTGAAGG - Intergenic
999552567 5:152705062-152705084 TTAACTAAATGTATCCCTTATGG - Intergenic
1002829715 6:808709-808731 TAAAATACATGTATCCCTGAAGG - Intergenic
1003500596 6:6699858-6699880 TCACATAAATGTTTCACTGAGGG + Intergenic
1016901800 6:149110030-149110052 TCACCTACATGAATATCTGATGG - Intergenic
1026223299 7:68419015-68419037 TCTCCTGTATGTATCCCTTAGGG - Intergenic
1029320005 7:99750472-99750494 TCACCTAGATCTTTCCCTGGGGG - Intergenic
1030173262 7:106626106-106626128 TCTCCTACATGTATTCCTCACGG - Intergenic
1033426674 7:141251000-141251022 TCAACTCTATGTTTCCCTAAAGG + Intronic
1036424944 8:8636270-8636292 AAATCTATATGTATCCATGAGGG + Intergenic
1039690312 8:39857582-39857604 TCACCTAAATTTACACCTGAAGG + Intergenic
1043952945 8:86329561-86329583 TCACCTATTTATATTCCTCAGGG - Intergenic
1044532064 8:93318439-93318461 TCTCCTCTATGTGTCCCTTAGGG + Intergenic
1050077968 9:1884405-1884427 TCACCTCTAAGTATGTCTGAGGG + Intergenic
1187598776 X:20803553-20803575 TCTCCTATAATTATTCCTGAAGG + Intergenic
1187736519 X:22310550-22310572 TCATCCATATGAATCCATGAAGG - Intergenic
1194938659 X:99982517-99982539 TCACCTACATTTATTACTGATGG - Intergenic
1195468903 X:105211374-105211396 TCCTCTGTATGTAGCCCTGAAGG + Intronic
1196459328 X:115913455-115913477 GAAACTATTTGTATCCCTGAGGG + Intergenic