ID: 917609114 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:176668265-176668287 |
| Sequence | TGCTCTCTATGCTCTAGATA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 136 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 9, 4: 125} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 917609114_917609117 | -3 | Left | 917609114 | 1:176668265-176668287 | CCTTATCTAGAGCATAGAGAGCA | 0: 1 1: 0 2: 1 3: 9 4: 125 |
||
| Right | 917609117 | 1:176668285-176668307 | GCATGAGGAAAGGTAGATCCTGG | 0: 1 1: 0 2: 0 3: 14 4: 206 |
||||
| 917609114_917609118 | 12 | Left | 917609114 | 1:176668265-176668287 | CCTTATCTAGAGCATAGAGAGCA | 0: 1 1: 0 2: 1 3: 9 4: 125 |
||
| Right | 917609118 | 1:176668300-176668322 | GATCCTGGCAGAAATTAAGCAGG | 0: 1 1: 0 2: 1 3: 8 4: 122 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 917609114 | Original CRISPR | TGCTCTCTATGCTCTAGATA AGG (reversed) | Intronic | ||