ID: 917609115

View in Genome Browser
Species Human (GRCh38)
Location 1:176668270-176668292
Sequence TCTAGAGCATAGAGAGCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917609113_917609115 9 Left 917609113 1:176668238-176668260 CCTTCAGGGATACATATAGGTGA 0: 1
1: 0
2: 0
3: 7
4: 83
Right 917609115 1:176668270-176668292 TCTAGAGCATAGAGAGCATGAGG 0: 1
1: 0
2: 0
3: 20
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917609115 Original CRISPR TCTAGAGCATAGAGAGCATG AGG Intronic