ID: 917609115 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:176668270-176668292 |
| Sequence | TCTAGAGCATAGAGAGCATG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 188 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 20, 4: 167} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 917609113_917609115 | 9 | Left | 917609113 | 1:176668238-176668260 | CCTTCAGGGATACATATAGGTGA | 0: 1 1: 0 2: 0 3: 7 4: 83 |
||
| Right | 917609115 | 1:176668270-176668292 | TCTAGAGCATAGAGAGCATGAGG | 0: 1 1: 0 2: 0 3: 20 4: 167 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 917609115 | Original CRISPR | TCTAGAGCATAGAGAGCATG AGG | Intronic | ||