ID: 917610011

View in Genome Browser
Species Human (GRCh38)
Location 1:176679611-176679633
Sequence CCACTTGACCCAAGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 2, 1: 0, 2: 2, 3: 18, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917610006_917610011 9 Left 917610006 1:176679579-176679601 CCTTCTCTTTTCACAGGGCATGA 0: 1
1: 2
2: 4
3: 17
4: 370
Right 917610011 1:176679611-176679633 CCACTTGACCCAAGGGCAGCTGG 0: 2
1: 0
2: 2
3: 18
4: 149
917610004_917610011 11 Left 917610004 1:176679577-176679599 CCCCTTCTCTTTTCACAGGGCAT 0: 1
1: 2
2: 3
3: 30
4: 338
Right 917610011 1:176679611-176679633 CCACTTGACCCAAGGGCAGCTGG 0: 2
1: 0
2: 2
3: 18
4: 149
917610005_917610011 10 Left 917610005 1:176679578-176679600 CCCTTCTCTTTTCACAGGGCATG 0: 1
1: 3
2: 0
3: 38
4: 311
Right 917610011 1:176679611-176679633 CCACTTGACCCAAGGGCAGCTGG 0: 2
1: 0
2: 2
3: 18
4: 149
917610003_917610011 12 Left 917610003 1:176679576-176679598 CCCCCTTCTCTTTTCACAGGGCA 0: 1
1: 2
2: 1
3: 35
4: 326
Right 917610011 1:176679611-176679633 CCACTTGACCCAAGGGCAGCTGG 0: 2
1: 0
2: 2
3: 18
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917610011 Original CRISPR CCACTTGACCCAAGGGCAGC TGG Intronic
900347224 1:2215537-2215559 CCAGTGGTCCCAAGGGCAGCGGG - Intergenic
903015542 1:20359183-20359205 CCACTTGAGCCAAAGCCACCTGG - Intergenic
903175510 1:21577863-21577885 CCTGTTGGCCAAAGGGCAGCGGG - Exonic
903225974 1:21894450-21894472 GGACCTGCCCCAAGGGCAGCTGG + Intronic
905778918 1:40691032-40691054 CCACTTGGTCCAAAGGCATCAGG - Intergenic
906718299 1:47986889-47986911 CCACTTAATCCACAGGCAGCCGG - Intronic
910631917 1:89364286-89364308 CCACTTGAACCAGTGACAGCCGG + Intronic
912456643 1:109802662-109802684 CCACTGGGCTCCAGGGCAGCTGG - Intergenic
912506676 1:110161489-110161511 CCACAAGACCCAAGGGTAGCAGG + Intronic
914947492 1:152079876-152079898 CTACTTGATCCAAGAGCTGCAGG + Intergenic
917610011 1:176679611-176679633 CCACTTGACCCAAGGGCAGCTGG + Intronic
920258413 1:204672425-204672447 CCAATTGACCCAAGGGCTAAAGG - Intronic
923163346 1:231337139-231337161 CCACATGGCCCAACTGCAGCGGG - Exonic
1066026336 10:31363118-31363140 CTACTTGATCCAAGAGCTGCAGG + Intronic
1067472909 10:46549258-46549280 CCCCTGGACCCACCGGCAGCTGG - Exonic
1068716946 10:60199120-60199142 ACAATTCACCCAAGGGCAGGAGG + Intronic
1068855552 10:61794258-61794280 CCACTTCACTCCTGGGCAGCTGG - Intergenic
1072164792 10:92802737-92802759 CCACCTGTTCCATGGGCAGCTGG - Intergenic
1074093452 10:110285698-110285720 CCATGTGGCCTAAGGGCAGCAGG - Exonic
1077326263 11:1965378-1965400 CCAGATGACCCCAGGGCAGCTGG + Intronic
1084678649 11:70652014-70652036 CCACTAAACCCAAGGGATGCTGG + Intronic
1085351956 11:75803325-75803347 CCACTACACCCAGGGGCAGGTGG - Intergenic
1088143955 11:106652231-106652253 CCACTGGAGCCAAGGGCACCAGG + Intergenic
1088745123 11:112798617-112798639 CCACTTCATGCAAGGGCACCAGG - Intergenic
1089078347 11:115756987-115757009 CTATTGGAGCCAAGGGCAGCAGG + Intergenic
1090955536 11:131510310-131510332 CCACTTCAGCCCAGAGCAGCAGG + Intronic
1202809244 11_KI270721v1_random:20557-20579 CCAGATGACCCCAGGGCAGCTGG + Intergenic
1092932149 12:13326231-13326253 CTCCTTGCCCCAAGGGCTGCAGG + Intergenic
1094460773 12:30695401-30695423 CCACTGGACCGGGGGGCAGCGGG + Intronic
1095348035 12:41175823-41175845 CCTGTTCACCCAAGGGAAGCTGG + Intergenic
1095749995 12:45699213-45699235 CCAGTTTCCCCAAGGGCAGAGGG - Intergenic
1096462267 12:51828628-51828650 CCACAGGACCCGAGGGCAGCAGG - Intergenic
1096599317 12:52718231-52718253 CCACATGACCAAAGTGGAGCTGG - Intergenic
1096658460 12:53106080-53106102 CCTCTTGCCCCAAGGGCAGGTGG - Intronic
1096993122 12:55821118-55821140 CCCCCTCACCCAAGGGCAGTGGG + Exonic
1098756155 12:74365619-74365641 TTAGTGGACCCAAGGGCAGCAGG + Intergenic
1101365197 12:104064456-104064478 CCACGTGACCCCAGCACAGCTGG + Exonic
1103845818 12:123901395-123901417 CTACTTGTCCCTGGGGCAGCAGG - Intronic
1104929415 12:132329895-132329917 AAGCTTGACCCGAGGGCAGCGGG + Intergenic
1106340826 13:28824987-28825009 CCACCTGACCAGAGTGCAGCTGG + Intronic
1107938240 13:45362987-45363009 ACACTTGACCCAAGTGAAGTGGG - Intergenic
1108114151 13:47109466-47109488 CCATTTGACCCAGAGGCTGCAGG - Intergenic
1108786276 13:53905745-53905767 CCACTTGACCCAAGGGCAGCTGG - Intergenic
1110046819 13:70842130-70842152 CTTCTTGGCCCACGGGCAGCAGG - Intergenic
1110626696 13:77661695-77661717 CTACTTGATCCAAGAGCTGCAGG + Intergenic
1118328376 14:64796824-64796846 CCACGTCACCCAAGAGCATCAGG - Intronic
1119922333 14:78457884-78457906 CCACATCACCCATGGGCATCAGG - Intronic
1120191761 14:81446284-81446306 CCTCTGGACCTGAGGGCAGCTGG + Intergenic
1122206103 14:100148812-100148834 GCACTTGTCCCCAGGGCAGGAGG - Intronic
1122833784 14:104421213-104421235 TCCCTTCACCCAAGGGCACCAGG - Intergenic
1123806758 15:23881660-23881682 CCACCTGACTCAAGCCCAGCCGG + Intergenic
1124216185 15:27808692-27808714 GCACTTGACACAAGGGCAGCTGG + Intronic
1124399152 15:29333431-29333453 CCACTTGACACAGGCGCATCAGG + Intronic
1127916519 15:63459497-63459519 CCACTAGACTCAAGCCCAGCTGG - Intergenic
1128879724 15:71232050-71232072 CCGCTTGAGCCAAGGCAAGCTGG - Intronic
1130299221 15:82667262-82667284 CCTCTTTACTCTAGGGCAGCAGG + Intronic
1131075915 15:89494882-89494904 CCACTTGACCCCAGAGCATAAGG - Intronic
1131510519 15:93047369-93047391 CCCCCTGGACCAAGGGCAGCTGG + Intronic
1134308611 16:13056185-13056207 ACACTTTATCCCAGGGCAGCAGG + Intronic
1137470013 16:48745783-48745805 CCAGTTGACCCCAGGCAAGCCGG + Intergenic
1138411281 16:56842416-56842438 CCACTTGACCCATGCACTGCTGG - Intronic
1138829344 16:60358774-60358796 CTACTTGATCCAAGAGCTGCAGG + Exonic
1141834306 16:86528558-86528580 ACTCTTGACACAAGGGCACCAGG + Intergenic
1142007665 16:87697396-87697418 CCACCAGACCCCAGGGAAGCCGG + Exonic
1142285475 16:89169876-89169898 CCACATGCTCCCAGGGCAGCAGG - Intergenic
1144882876 17:18439621-18439643 CCACTGGCCCCAAGGGCTCCAGG + Intergenic
1145149355 17:20504765-20504787 CCACTGGCCCCAAGGGCTCCAGG - Intergenic
1146340179 17:32012109-32012131 ACACTTTACCTAACGGCAGCAGG - Intronic
1146599624 17:34203447-34203469 CCAATTAATGCAAGGGCAGCTGG + Intergenic
1147198952 17:38786584-38786606 CCACATGCCCCAAGGGCCACCGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151787585 17:76282747-76282769 ACAGCTGATCCAAGGGCAGCCGG + Intronic
1152070189 17:78130509-78130531 CCAGTGGACCCTAGGGCTGCAGG + Intronic
1152178044 17:78800671-78800693 GCACCAGACCCAAGGGCAGGAGG - Intronic
1152324601 17:79628196-79628218 TGACTTGAGCCAAGGGCAGCTGG - Intergenic
1152931002 17:83109834-83109856 CCTCTTGCCCCAAGCCCAGCCGG + Intergenic
1153746782 18:8187460-8187482 CCACCTGACCTAAAGGCACCAGG - Intronic
1153901504 18:9621394-9621416 CCATTCAAGCCAAGGGCAGCTGG - Intergenic
1159999569 18:75003912-75003934 ACACTTGAGCAAATGGCAGCAGG + Intronic
1161272701 19:3398760-3398782 CCAGTTTATGCAAGGGCAGCCGG + Intronic
1162915197 19:13870952-13870974 TCACCTGACCCCAGTGCAGCTGG - Intronic
1167113707 19:47476597-47476619 CCACGTGAGCCATGGCCAGCAGG + Exonic
1167981052 19:53276138-53276160 CCACTGCACCCACGGGCAGAAGG + Intergenic
926047511 2:9720594-9720616 CCAGTTGCCCCAAGGAGAGCAGG - Intergenic
926198786 2:10778873-10778895 ACACTTGCCCCAAGTGTAGCAGG - Intronic
932063252 2:68528533-68528555 CTACTTGATCCAAGAGCTGCAGG + Intronic
934935125 2:98459841-98459863 CAACTTGACCTCAGGGAAGCAGG - Intronic
937156828 2:119725574-119725596 TCACCTGACCCAAGGGCGGCGGG + Intergenic
938107634 2:128544333-128544355 CCTCTTGACCCAAGAGCAGGAGG + Intergenic
942062415 2:172240054-172240076 CCACTTGGCCCAAGGACAACAGG + Intergenic
942768409 2:179485282-179485304 CCACTTAAGCAAAGGGCAGAAGG - Intronic
942891246 2:180991550-180991572 CCAGGTGGCCCAAGGGCCGCAGG - Intronic
948455152 2:238101413-238101435 CCGCCAAACCCAAGGGCAGCAGG + Intronic
1169000451 20:2164271-2164293 TGACTTGAACCAAGGGCTGCTGG + Intronic
1170745965 20:19099168-19099190 CCACCTGCCCCGAAGGCAGCAGG - Intergenic
1172119271 20:32588269-32588291 CCTCTTGCCCCAAGGGCTCCTGG + Intronic
1172146690 20:32762538-32762560 CCACTTAACCCCAGCGCTGCCGG - Exonic
1174133136 20:48359880-48359902 CCACGTGACCCAGGGGGAGGTGG - Intergenic
1175780385 20:61678732-61678754 CCACTGGACGCCAGGGCAGCTGG - Intronic
1175810603 20:61855358-61855380 TCACTGGAACCATGGGCAGCTGG + Intronic
1177835144 21:26179451-26179473 TCACTTGAACCCGGGGCAGCGGG - Intergenic
1179537849 21:42063732-42063754 CCACTGGGGCCAAGGGGAGCCGG - Intronic
1179642235 21:42755404-42755426 TCAGTTCACCCAAGAGCAGCAGG + Intronic
1179823579 21:43951536-43951558 CCCCAGGACCCAAGGACAGCAGG + Intronic
1180918477 22:19505981-19506003 CCTTGTGAGCCAAGGGCAGCGGG + Intronic
952159777 3:30682004-30682026 CCACCTGACTCAAAGGAAGCTGG + Intronic
953673390 3:44981343-44981365 CCATTTTACACAAGGGAAGCAGG - Intronic
955823883 3:62924594-62924616 GCATCTGACCCAGGGGCAGCTGG + Intergenic
960495897 3:118374697-118374719 CCACCTGAGCCAAGGGAGGCAGG + Intergenic
961813278 3:129533939-129533961 CCACGTTCCCCAAGGCCAGCGGG + Exonic
963224515 3:142848309-142848331 CCACTGGACACAAGGGCTCCAGG + Exonic
963239287 3:142987066-142987088 TCACTTGAACCCAGGGCAGGGGG + Intronic
966332253 3:178827252-178827274 CCAGTTGACCAATGGGCAGCTGG + Intronic
967979384 3:195056516-195056538 CCACTTACCCCAAGGGAACCTGG + Intergenic
968513022 4:1003569-1003591 GCCCCTGACCCAAGGGCAGCTGG + Exonic
969248804 4:5953959-5953981 GCACTTGGTCCAAGGGCAGAAGG - Intronic
970108609 4:12612693-12612715 TCACTCGACCCAAGCCCAGCAGG - Intergenic
970510473 4:16777017-16777039 CCGCCTGACCCAAGGACATCTGG - Intronic
970606466 4:17686446-17686468 CCCCTTAACCCAATGACAGCTGG + Intronic
974022070 4:56700617-56700639 CATCTTGCCACAAGGGCAGCTGG - Intergenic
976127466 4:81849195-81849217 CCACTTGACCCAGTGGTGGCGGG - Intronic
985639853 5:1058506-1058528 CCACTCGTCCCAGGGGCATCAGG + Intronic
991522252 5:67514194-67514216 ACACTTGAGCCAAGGGGATCTGG - Intergenic
992464768 5:76992913-76992935 CCACATGGCCCATGGGCCGCTGG + Intergenic
997440520 5:133905816-133905838 CCTCTAGCCACAAGGGCAGCTGG - Intergenic
999052188 5:148534643-148534665 GCACTTGACCCAAGGAGAGGAGG + Intronic
999947760 5:156615814-156615836 CCACTACACCCAACCGCAGCTGG - Intronic
1000008344 5:157208611-157208633 CCATTTGTCACAAGGGCAGTGGG + Intronic
1004400678 6:15285901-15285923 CCACTTGATGAAAGAGCAGCAGG + Intronic
1007915886 6:45561369-45561391 CCATATGAACCAAGGGCAGAGGG + Intronic
1008730886 6:54481286-54481308 CCACTTGGCCGATGGCCAGCTGG + Intergenic
1009398552 6:63229405-63229427 CTACTTGATCCAAGAGCTGCAGG + Intergenic
1009494196 6:64328539-64328561 CCATTTGACCCAGAGGCTGCGGG + Intronic
1011900147 6:92284250-92284272 CCACGGGCCCCAAAGGCAGCTGG - Intergenic
1013174354 6:107664428-107664450 CCACTGCCCCCAAGGGCAGTCGG + Intergenic
1015811425 6:137165296-137165318 CCACTTGACCCAGAGGCTGCGGG + Intronic
1016694167 6:146973575-146973597 CCACTAGCCCAAAGGGGAGCAGG - Intergenic
1017416503 6:154226760-154226782 AGACTTGACCCGAGGGCAGCTGG - Intronic
1024506058 7:50162837-50162859 CCACATAACCCAGTGGCAGCAGG - Intergenic
1027610160 7:80350760-80350782 CCATTTGGTCTAAGGGCAGCAGG + Intergenic
1030768834 7:113447278-113447300 TCTTTTGACCCAAGGGCACCTGG - Intergenic
1031061789 7:117060131-117060153 CCAGTTGACACAAGTGCAGTGGG + Intronic
1036181452 8:6588800-6588822 TGACCTGGCCCAAGGGCAGCTGG - Intronic
1038222795 8:25626862-25626884 CCACTTACCCCACCGGCAGCTGG + Intergenic
1040023443 8:42761047-42761069 CCACGTGGCCCAGGGGAAGCTGG - Intronic
1040398798 8:47026308-47026330 CCATTTGACCTAAGGGCAGCTGG - Intergenic
1040738027 8:50534694-50534716 CCACTTGACCCCAGGGGCGGAGG + Intronic
1043072609 8:75657701-75657723 CCACTTGGTCCATGTGCAGCAGG - Intergenic
1046097174 8:109575660-109575682 CCTCTTGACACAATGGCAGATGG - Exonic
1047437619 8:124847807-124847829 TCACTTGACCCTAGGGCTGCTGG + Intergenic
1047507052 8:125488260-125488282 CCATTTTACCAAAGGGCAGACGG - Intergenic
1048058532 8:130892886-130892908 CCACTTGACCCAAGTTAACCTGG - Intronic
1048574761 8:135681750-135681772 CCACATCACCCAGAGGCAGCAGG - Intergenic
1050242035 9:3646833-3646855 GCATTTGACCACAGGGCAGCAGG + Intergenic
1052413410 9:28148895-28148917 CTACTTGACCCAAGAGCTGCAGG - Intronic
1052712551 9:32074702-32074724 CCACTTGACCCAAGTGGAAAGGG + Intergenic
1056020197 9:82432208-82432230 CTACTTGATCCAAGAGCTGCAGG + Intergenic
1056576343 9:87858353-87858375 CTACTTGATCCAAGAGCTGCAGG + Intergenic
1056580859 9:87887336-87887358 CGACTGGACACAAGGGCAGGGGG + Exonic
1057071700 9:92105110-92105132 CTACTTGATCCAAGAGCTGCAGG - Intronic
1058974777 9:110115530-110115552 CCACTTAACCCTAGTGGAGCAGG + Intronic
1059431256 9:114251760-114251782 CCTCTTGACCCAAGAGCTGAAGG - Intronic
1060108029 9:120886618-120886640 CCAGATGACCCAATGTCAGCTGG + Intronic
1060771251 9:126333748-126333770 ACAGTTCACCCAAGGGCACCAGG - Intronic
1062460779 9:136661776-136661798 CAACTTGAGCCAAGGGAGGCTGG - Intronic
1187846030 X:23538808-23538830 CCACTTCAGCCAAGAGTAGCTGG + Intergenic
1191156136 X:57275389-57275411 CTACTTGACCCACGGGGAACTGG - Intergenic
1196165120 X:112530331-112530353 ACACTTGACATAAGGGCAGTAGG - Intergenic
1198297898 X:135304966-135304988 GGACTTGACCCAAGGCCAACTGG + Intronic
1200363342 X:155634502-155634524 CCAAATCACCCAAAGGCAGCTGG + Intronic
1201896290 Y:18996279-18996301 CCATTTGACCCAGAGGCTGCGGG + Intergenic