ID: 917611035

View in Genome Browser
Species Human (GRCh38)
Location 1:176689239-176689261
Sequence CAAGCTACACAGATAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917611031_917611035 14 Left 917611031 1:176689202-176689224 CCATGGGAGAGGAGGAAAGCAGG 0: 1
1: 0
2: 9
3: 69
4: 532
Right 917611035 1:176689239-176689261 CAAGCTACACAGATAGAAGTTGG 0: 1
1: 0
2: 1
3: 12
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917611035 Original CRISPR CAAGCTACACAGATAGAAGT TGG Intronic
901386838 1:8915615-8915637 CAAGCTAAACAGATAGCAACAGG + Intergenic
902720983 1:18303764-18303786 CTAGCAACACAGAGAGAGGTGGG + Intronic
904886262 1:33740924-33740946 AAAGGTACACAGGGAGAAGTGGG - Intronic
905390432 1:37632966-37632988 CACTCTACACAGATAGAATGGGG + Intronic
909139707 1:71848125-71848147 GAAGCTACAGAGAAAAAAGTTGG + Intronic
909976047 1:82047267-82047289 CAAGCTACACAGATGGGAAGTGG + Intergenic
910124231 1:83822694-83822716 CAAGCTACATAAAGACAAGTAGG + Intergenic
910865674 1:91786297-91786319 CAAGCTAGACAGAAAGAATCAGG + Intronic
911715772 1:101131215-101131237 CAAGTTTCACATATGGAAGTGGG - Intergenic
913068910 1:115282886-115282908 AAAGTTTCACAGATAGAAATGGG + Intergenic
913647962 1:120879157-120879179 AAAGAGACACAGATAGAAATAGG - Intergenic
914078665 1:144383682-144383704 AAAGAGACACAGATAGAAATAGG + Intergenic
914100514 1:144582820-144582842 AAAGAGACACAGATAGAAATAGG - Intergenic
914173572 1:145252230-145252252 AAAGAGACACAGATAGAAATAGG + Intergenic
914298470 1:146354833-146354855 AAAGAGACACAGATAGAAATAGG + Intergenic
914528227 1:148493371-148493393 AAAGAGACACAGATAGAAATAGG + Intergenic
914638160 1:149573696-149573718 AAAGAGACACAGATAGAAATAGG - Intergenic
915288830 1:154869521-154869543 CAAGTTCCACAGCTACAAGTGGG - Exonic
917611035 1:176689239-176689261 CAAGCTACACAGATAGAAGTTGG + Intronic
920988252 1:210910999-210911021 CAATCTACACAAATGCAAGTAGG - Intronic
921095643 1:211885103-211885125 CAAGCAACACTCCTAGAAGTTGG - Intergenic
921489610 1:215758606-215758628 CAAGCTACAAATATAGAATAAGG + Exonic
921500712 1:215899352-215899374 CAAGCTACACAGAGTGAATAAGG - Intronic
923642210 1:235775667-235775689 AAGGCTACACAGAGAGAAGATGG + Intronic
1063022164 10:2140209-2140231 CAAACAACACATAGAGAAGTTGG + Intergenic
1063260029 10:4377642-4377664 CATGCAAAACAGATAGAAATGGG + Intergenic
1066069354 10:31790702-31790724 CAAATTAAACAGAAAGAAGTAGG - Intergenic
1066663062 10:37755417-37755439 CGACCTCCACAGATAGAATTTGG + Intergenic
1067381628 10:45779109-45779131 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1067889327 10:50119743-50119765 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1068510684 10:57962141-57962163 ATAGGTACACAAATAGAAGTAGG - Intergenic
1072296150 10:94011239-94011261 CAAGCAAGACAGAGAGAAGGGGG + Intronic
1074186677 10:111104226-111104248 CAGACTAGACAGATAGGAGTGGG - Intergenic
1074316333 10:112364742-112364764 CAAGGTACACAGCTAACAGTTGG - Intergenic
1086646405 11:89227039-89227061 CAAGCTACCCAGGTAGAGTTGGG - Intronic
1086919818 11:92573637-92573659 AGAGCTACACAGAGAGAAGAAGG + Intronic
1087712953 11:101575426-101575448 AATGCTACACAGCTAGCAGTTGG - Intronic
1088502347 11:110495078-110495100 AAAGATACACAGATATAAGAAGG - Intergenic
1089922833 11:122227130-122227152 CAATCCACAGAGAGAGAAGTAGG + Intergenic
1090489691 11:127147853-127147875 CTTGCTCCACAGAGAGAAGTAGG - Intergenic
1091621627 12:2093474-2093496 TGAGCTGCACAGATGGAAGTGGG + Intronic
1093377026 12:18441926-18441948 AAAAATACACAGATAGACGTAGG - Intronic
1094685577 12:32710717-32710739 CATGATACAGGGATAGAAGTAGG + Intronic
1095107789 12:38256605-38256627 CAATCTCCACAGATTGAATTGGG - Intergenic
1095726329 12:45457030-45457052 CAAGCTACACCCATAGAAGATGG + Intergenic
1099961945 12:89405316-89405338 CAAGTTACTCAGGTAGTAGTGGG + Intergenic
1102066828 12:109984047-109984069 CAGGCCACACAGCTTGAAGTGGG - Intronic
1103636962 12:122314859-122314881 CAAGTGACACAAATAGAAGATGG - Intronic
1104546623 12:129718737-129718759 CAAGCTACACAGCTAGTAAGAGG - Intronic
1108926978 13:55762192-55762214 CAAGAGACACATATAGCAGTGGG + Intergenic
1109288606 13:60444118-60444140 CAAGTTACAGAAATAGAAGGTGG - Intronic
1109453755 13:62555133-62555155 CAAACTACAAAGATTGAAATAGG - Intergenic
1111204349 13:84984908-84984930 GAACCTACACAGATATATGTTGG - Intergenic
1112855143 13:103759589-103759611 CAAGTCACACAAATAGAAATTGG - Intergenic
1120343808 14:83257647-83257669 CAATTTAACCAGATAGAAGTGGG + Intergenic
1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG + Intronic
1127693279 15:61418864-61418886 CAAGGGACACAGAAAGGAGTTGG + Intergenic
1130242130 15:82203941-82203963 TAAGATACACACCTAGAAGTGGG + Intronic
1130458246 15:84136880-84136902 TAAGATACACACCTAGAAGTGGG - Intergenic
1135538298 16:23311493-23311515 CAACCTCCACACATAGACGTAGG - Intronic
1136646145 16:31617852-31617874 ACAGATACACAGAGAGAAGTGGG + Intergenic
1136659040 16:31738818-31738840 ATAGATACACAGAGAGAAGTGGG - Intronic
1137514035 16:49127011-49127033 CAAGTTACACACATAGCAGGTGG - Intergenic
1138194754 16:55043939-55043961 CAAGCCACACAGCTACAAATTGG + Intergenic
1138828531 16:60351209-60351231 CAGGTTACACAGACAGAGGTTGG + Intergenic
1141474537 16:84263882-84263904 CAAGACACACAGAGAGAAGCTGG + Intergenic
1146593810 17:34152601-34152623 CCAGCTACAAAGATGGAAGGTGG - Intronic
1146840657 17:36151080-36151102 CATGCTACACAGACAGATGAGGG - Intergenic
1150428395 17:65095510-65095532 CTTGCTACTCAGATTGAAGTTGG + Intergenic
1150535236 17:66031956-66031978 AAAGCAACACACAGAGAAGTGGG + Intronic
1156735630 18:40255217-40255239 AAAGCTAGAGAAATAGAAGTTGG + Intergenic
1157548971 18:48567653-48567675 CATGCTAGTCAGAAAGAAGTGGG + Intronic
1158789047 18:60752931-60752953 CCAGCTATACACCTAGAAGTAGG - Intergenic
1159117775 18:64135361-64135383 CAAGCTGAAAAGAAAGAAGTCGG - Intergenic
1159978513 18:74746646-74746668 CAAGATACAGAGATGGAAGATGG - Intronic
1164880465 19:31728363-31728385 GAGGGCACACAGATAGAAGTGGG + Intergenic
1165881527 19:39047422-39047444 AAAGATACACAGAAAGAAGGGGG - Intergenic
1167188777 19:47967831-47967853 CAAGCAACACAGATGGAAGTAGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167609057 19:50497499-50497521 GAAGAGACAGAGATAGAAGTGGG + Intergenic
927162607 2:20282108-20282130 CCAGCTGCACCGATAGAACTGGG + Intronic
928157437 2:28889393-28889415 CAAGCTGGAAAGATAGGAGTTGG + Intergenic
929060065 2:37914572-37914594 CAAGCCCCACAGGTAGAAGAGGG + Intergenic
929259736 2:39852138-39852160 AAACCTACAGATATAGAAGTGGG - Intergenic
932597586 2:73103698-73103720 CAAACCACACAGAAAGATGTGGG + Intronic
932973338 2:76572628-76572650 CAAGCTATCAAGATAGATGTAGG + Intergenic
933116122 2:78474411-78474433 CAAACTACATAGCAAGAAGTTGG + Intergenic
934125357 2:88883230-88883252 CAAACTGCACAAATAGCAGTAGG + Intergenic
935507409 2:103922710-103922732 CAAACTACACAGAACAAAGTAGG - Intergenic
936979126 2:118247793-118247815 CAAGCTACCTAGAGAGAAGCAGG - Intergenic
939386314 2:141503585-141503607 CAAATTATACAGATAGAAGGAGG - Intronic
941015170 2:160347662-160347684 CAACTTCCACAGATAGAAATTGG - Intronic
941555060 2:166968094-166968116 CTAGCTAAACATATAGAAGAAGG + Intronic
943968831 2:194375982-194376004 CAAACTACACAGATAATATTAGG - Intergenic
945218121 2:207456361-207456383 GAAGCTAAATAGATTGAAGTTGG + Intergenic
946547093 2:220756144-220756166 CCAGCGACACAGATTCAAGTTGG - Intergenic
948149696 2:235735382-235735404 CAGTCTACACAGAGACAAGTCGG - Intronic
948840148 2:240644805-240644827 CCAGCTACACAGGAAGATGTTGG + Intergenic
1169692448 20:8346932-8346954 CTAGCTAGACAGATAGAAGGAGG + Intronic
1171011421 20:21511284-21511306 CAAGCCACAAAGAAAGGAGTTGG + Exonic
1173069147 20:39744684-39744706 CAAGCTACACACCCTGAAGTGGG + Intergenic
1175159371 20:56996323-56996345 CAAGCCACACAGGTAGAGGCCGG - Intergenic
1175558601 20:59896114-59896136 CAAAGTACACAGCTGGAAGTGGG + Intronic
1182044786 22:27265795-27265817 AAGGCTTCACAGATAGAAGTTGG + Intergenic
1184524421 22:45013381-45013403 CAAGCTGCACAGCTATAAATGGG + Intergenic
949136345 3:571137-571159 GAAGCAAGACAGATAGGAGTTGG - Intergenic
949346853 3:3084745-3084767 GAAGCTACACAGATAGTAGGTGG - Intronic
952213167 3:31249994-31250016 CAAACTCCAAAGATTGAAGTGGG - Intergenic
953599934 3:44352437-44352459 CAAGCTATGGAGATAAAAGTGGG - Intronic
953799493 3:46011438-46011460 CAAGCCACACTGATGGAAGGAGG + Intergenic
954393425 3:50279419-50279441 GAAGCTACCCAGTTAGGAGTGGG + Intronic
954611767 3:51948116-51948138 CAAGTTTCCCAGAGAGAAGTCGG + Intronic
961917519 3:130392697-130392719 CAAGTTACAGATATGGAAGTGGG - Intronic
962047091 3:131771858-131771880 CCTGCTACACAGTTAGAGGTTGG + Intronic
963380113 3:144518723-144518745 CAAGCTACACAGATGATAGAAGG + Intergenic
964931310 3:162027952-162027974 TAAGCTACACAGATAGTTGTGGG + Intergenic
965102588 3:164320058-164320080 TAAGCTGCAGAGATAGAAATTGG - Intergenic
967174102 3:186847000-186847022 AGAGCTACACAGAGAGGAGTCGG - Intronic
967811415 3:193764206-193764228 CAACCTCCATAGATAAAAGTAGG + Intergenic
967912327 3:194552598-194552620 CAAGCTACACAGATATCTGTGGG - Intergenic
969340295 4:6536080-6536102 CAGGCTACACAGAGTGAGGTGGG - Intronic
970667313 4:18352796-18352818 CAACCTACTAAGATTGAAGTAGG - Intergenic
971483290 4:27133552-27133574 CCTACTACACATATAGAAGTAGG - Intergenic
971752543 4:30668861-30668883 CAAGCTACAGAGAGAGACATGGG - Intergenic
974445613 4:61977162-61977184 GCACCTACACAGATAAAAGTGGG + Intronic
975813824 4:78196811-78196833 CAAGCCCCACAAATTGAAGTTGG - Intronic
976570670 4:86605584-86605606 AAGGCTACAAAGATAGATGTGGG + Intronic
979801742 4:124918096-124918118 CAAACAAAACAGATAGAAATTGG - Intergenic
980254317 4:130357828-130357850 CAAGGTACAAAGATATAAGGTGG + Intergenic
981082890 4:140652616-140652638 CAAGCTGCACAGCTAGAAAGTGG - Intronic
981107528 4:140897891-140897913 AAAGTTACACAGATAGCAGGTGG + Intronic
982607026 4:157528181-157528203 CAAGCTACAGAGATATTAGTGGG - Intergenic
984700198 4:182814174-182814196 CTAGCTGCCCAGATGGAAGTAGG + Intergenic
985841731 5:2311039-2311061 CAAGCAACACAGAGAAATGTTGG - Intergenic
986353716 5:6904003-6904025 CAAGTGTCACAGATAGAAGCCGG - Intergenic
986409565 5:7463876-7463898 CAAGCTACAAAGAAAGCAATGGG + Intronic
988894344 5:35655787-35655809 TAAGATACACAGAAAGAAATAGG + Intronic
989979237 5:50622721-50622743 AAAGAGACACAGATAGAAATAGG - Intergenic
990593908 5:57294179-57294201 CAAGCTACAGAGATGGGAGTAGG + Intergenic
990988666 5:61663836-61663858 AAAGTTACACAGTTAGCAGTTGG + Intronic
993377706 5:87169044-87169066 CAAGCTTCCTAGATAGAAGAGGG - Intergenic
996217768 5:120890177-120890199 CAAGCTTCCCAGATTGAACTAGG - Intergenic
996632510 5:125651530-125651552 CTAGGTATACACATAGAAGTGGG - Intergenic
997193800 5:131963944-131963966 AAAGCCACACAGCTAGAAGTTGG + Intronic
997240902 5:132307224-132307246 CAAGTGACAAAGATAGAACTGGG + Intronic
999222545 5:149992717-149992739 CAAGGCACACAGGCAGAAGTCGG + Intronic
999682616 5:154074230-154074252 TGAGTCACACAGATAGAAGTGGG - Intronic
999862815 5:155666806-155666828 CAAGCTACACAGAATGAGCTTGG + Intergenic
1000188300 5:158882502-158882524 CAAGCTAGAAAGATAGGTGTTGG + Intronic
1000782643 5:165502268-165502290 CAAACTACACCCATAGAAGAGGG - Intergenic
1000803066 5:165752445-165752467 CAGACTAAATAGATAGAAGTAGG - Intergenic
1001132554 5:169076508-169076530 CAAGCTAGAGAGAGAGAGGTAGG - Intronic
1002075263 5:176704754-176704776 CTGGCCACACAGATAGAAGCAGG + Intergenic
1009326297 6:62352405-62352427 GAAGCTAGGCAGTTAGAAGTAGG - Intergenic
1010104293 6:72149229-72149251 CAAACTACACAGATATTACTGGG - Intronic
1013298045 6:108777579-108777601 CAAGATAAACTGCTAGAAGTGGG - Intergenic
1013560449 6:111298376-111298398 CAATCTACACATATAAAAGGGGG + Intergenic
1014057571 6:117034054-117034076 CAAGAAACAAGGATAGAAGTAGG + Intergenic
1014241257 6:119020455-119020477 CAAGCTAAACAGGTTGAAGTAGG + Intronic
1015768601 6:136745713-136745735 CCAGCTACACACACAGAAGAAGG + Intronic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1020663448 7:11009240-11009262 AAAGTTACACAGCTAGAAGATGG + Intronic
1022805474 7:33816984-33817006 CAAGTCACACAGATGGAAGGTGG + Intergenic
1023377797 7:39576150-39576172 AAAGCAACTCAGTTAGAAGTAGG - Intronic
1028383054 7:90220343-90220365 CAAGCTACCAAGATTGAAATGGG - Intronic
1028662592 7:93297513-93297535 CAAGGTTCACAGAAAGAATTTGG + Intronic
1028720484 7:94025251-94025273 CAAAATACACAGATAAAATTTGG + Intergenic
1030336029 7:108327198-108327220 CAAGCTACCCAGCTAGGAATAGG - Intronic
1032474180 7:132201136-132201158 GAAGCTACACAGGGAGAAGATGG + Intronic
1032748257 7:134809883-134809905 TAAGCTATACAGACAGAAATGGG + Intronic
1033239041 7:139662010-139662032 CAAGCTAAACATATAACAGTTGG - Intronic
1041749278 8:61241556-61241578 CAAAATACAAAGATAAAAGTAGG + Intronic
1043252572 8:78093595-78093617 CAAACTACACACACAGAATTTGG + Intergenic
1043617776 8:82148208-82148230 CAATCTAAACAGATTGAAGGAGG - Intergenic
1044839393 8:96325026-96325048 CTAGCCACACAGATAGATGACGG + Intronic
1044895994 8:96891785-96891807 CAAGCAACAGTGATAGAAGGTGG + Intronic
1045479970 8:102584023-102584045 CAACCTCCACAGACAAAAGTAGG + Intergenic
1045894579 8:107199410-107199432 AAATCTATAAAGATAGAAGTAGG - Intergenic
1046969713 8:120208380-120208402 CACTCTACAAAGTTAGAAGTGGG - Intronic
1047922516 8:129650200-129650222 CAAGCCACACAGCTAGAAAGTGG - Intergenic
1048022555 8:130553564-130553586 CAAGCTACCAAGATTGAAGCAGG - Intergenic
1048111985 8:131478033-131478055 AAAGCTGCACAGATAGAAAGTGG + Intergenic
1048170845 8:132104758-132104780 TACACTACACAGAGAGAAGTAGG + Intronic
1048251592 8:132870769-132870791 AAAGCTAGAGAGATAGAAGGTGG + Intronic
1055967215 9:81877147-81877169 CAATTTACACAGAAGGAAGTAGG - Intergenic
1056134516 9:83618844-83618866 AAAGCTGCAGAGATAGAAGGAGG - Intergenic
1059889339 9:118784112-118784134 TAAGCTGAACAGATAGGAGTTGG + Intergenic
1190119037 X:47645403-47645425 CAAGTCACACAGCTGGAAGTTGG + Intronic
1190938879 X:55021040-55021062 CAAGCCACACAGTGAGTAGTAGG - Exonic
1194612911 X:96065141-96065163 CAACCTACACAGATTGAACCAGG - Intergenic
1194720214 X:97331823-97331845 CAAACTAGACAACTAGAAGTTGG + Intronic
1196989202 X:121309239-121309261 CAAGGTACAGAGATAGAGTTTGG - Intergenic
1197602304 X:128544374-128544396 CAACCTACCCAGATTGAACTAGG - Intergenic
1200031486 X:153300013-153300035 CAAGCAAGACAGAGAGAAGGAGG - Intergenic
1201963519 Y:19707613-19707635 CCACACACACAGATAGAAGTCGG + Exonic