ID: 917612078

View in Genome Browser
Species Human (GRCh38)
Location 1:176699161-176699183
Sequence CCGTCATGTTCATGTGGTAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917612078_917612089 28 Left 917612078 1:176699161-176699183 CCTGTACCACATGAACATGACGG 0: 1
1: 0
2: 0
3: 1
4: 53
Right 917612089 1:176699212-176699234 GGAGCTGCTCTTCCAACACCCGG 0: 1
1: 0
2: 0
3: 19
4: 217
917612078_917612086 7 Left 917612078 1:176699161-176699183 CCTGTACCACATGAACATGACGG 0: 1
1: 0
2: 0
3: 1
4: 53
Right 917612086 1:176699191-176699213 CCCCACAGAAGGCTGTAGCTTGG 0: 1
1: 0
2: 1
3: 26
4: 177
917612078_917612081 -4 Left 917612078 1:176699161-176699183 CCTGTACCACATGAACATGACGG 0: 1
1: 0
2: 0
3: 1
4: 53
Right 917612081 1:176699180-176699202 ACGGTCCCCTGCCCCACAGAAGG 0: 1
1: 0
2: 4
3: 11
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917612078 Original CRISPR CCGTCATGTTCATGTGGTAC AGG (reversed) Exonic
906106557 1:43297399-43297421 CCGTCATGATCAAGAGGGACAGG - Intergenic
907801984 1:57777819-57777841 CCGTCATTTTTTTGTGGGACAGG + Intronic
917612078 1:176699161-176699183 CCGTCATGTTCATGTGGTACAGG - Exonic
922416109 1:225424970-225424992 CCAGCTAGTTCATGTGGTACTGG - Intronic
923042951 1:230332922-230332944 CCTTCATCTTGATTTGGTACTGG + Exonic
924740590 1:246792316-246792338 CTTTCAGGTTCATGTGGCACCGG - Intergenic
1064057054 10:12106559-12106581 CTGTCAGGTTAATGTGTTACTGG + Intronic
1074868378 10:117558258-117558280 CCGTAATGTTCATGAAGTGCTGG - Intergenic
1079744931 11:24113889-24113911 CCCTCATGTGAAGGTGGTACGGG + Intergenic
1088715493 11:112545574-112545596 CAGTCATGTTCAGGTTGTACAGG - Intergenic
1093481790 12:19611948-19611970 CACTCCTGTTCACGTGGTACTGG - Intronic
1095519555 12:43046422-43046444 ATGTTAGGTTCATGTGGTACAGG - Intergenic
1104330367 12:127838868-127838890 ACGTCATGCCTATGTGGTACGGG - Intergenic
1108956201 13:56161010-56161032 ACCTCATGTTCATGTGTTAGAGG + Intergenic
1109753013 13:66721144-66721166 CCGTCATGCTGTTGTTGTACAGG + Intronic
1119510490 14:75207439-75207461 CCCCCATGTTCCTGTGTTACTGG + Intergenic
1125591610 15:40857714-40857736 CCGTCCTGTTCAGCTGGTTCAGG + Exonic
1128881759 15:71250263-71250285 CAGTCTTATTAATGTGGTACCGG + Intronic
1138536560 16:57663455-57663477 TCCTCATCTTCATCTGGTACTGG + Exonic
1138543411 16:57702073-57702095 GCGTCAGGTCCATGTGGCACAGG - Exonic
1139591436 16:67935419-67935441 CCGTCATGTTCGGCTGGAACCGG + Exonic
1140204528 16:72922588-72922610 CACTCAGGTTCGTGTGGTACTGG - Intronic
1155447301 18:25925605-25925627 CTGTCATGTTCATTTGGTCAAGG + Intergenic
1160353684 18:78207948-78207970 CCCTCATCTTCCTGTGGTCCTGG + Intergenic
1165202423 19:34155976-34155998 CCGTTATGCACATGTGCTACTGG - Intergenic
925235456 2:2273407-2273429 CCATCATGTTCCTGTAGGACTGG + Intronic
925315566 2:2920249-2920271 CCTGCATGTTCATCTGGCACCGG + Intergenic
936894022 2:117406284-117406306 CAGATATGTTCATGTGGCACAGG - Intergenic
944821552 2:203437595-203437617 CGGTTATGTTCATGTGGTTATGG - Exonic
1170100268 20:12691375-12691397 CCGTAATTCTCATGTGTTACGGG - Intergenic
1173825906 20:46047489-46047511 CCCTCATGTTCATCTGCTCCTGG + Exonic
953373881 3:42412578-42412600 CAGGCATGTTCATGTGGTGGTGG - Intergenic
954900688 3:54016669-54016691 CCCACATTTTCATGTTGTACTGG + Intergenic
971589879 4:28453820-28453842 TCCACATGTTCTTGTGGTACAGG + Intergenic
976098131 4:81530858-81530880 CTTTCCTATTCATGTGGTACTGG + Intronic
978861668 4:113457498-113457520 CCCTCATGTACATCTGGTAGGGG - Exonic
983557072 4:169068423-169068445 CTCTCATGTTCTTGTGGTGCTGG - Intergenic
986457497 5:7933942-7933964 CTTTCATGTTCATGTGGTCGGGG + Intergenic
987635994 5:20542381-20542403 CCATCATGGTCTTGTGGTAAGGG + Intronic
995841586 5:116447446-116447468 CCGTCAGGTCCAGGTGGTGCTGG + Exonic
996269344 5:121584059-121584081 TCATCATGGTCATGTGGTCCAGG + Intergenic
997352102 5:133238511-133238533 CCCACATGTGCATGTGGTCCTGG - Intronic
998328506 5:141303608-141303630 CGGTCCTCTTCATGTGCTACGGG - Exonic
1005843823 6:29762362-29762384 ACGCCATGTACATGTGGTAGGGG - Intergenic
1013299846 6:108794722-108794744 GCCTCATGTTCATGTGGTGAAGG - Intergenic
1015433636 6:133159861-133159883 CCTTCATATGCATGTGATACAGG + Intergenic
1019540379 7:1548523-1548545 CCGTCATCTTCCTGTCGTTCTGG - Exonic
1019770538 7:2881420-2881442 CCGACATGTTCAGGAGGCACTGG - Intergenic
1030826623 7:114167523-114167545 CCGTAATTTTCATGTGTTATGGG + Intronic
1046701897 8:117410300-117410322 CAGTAATTTTCATGTTGTACAGG + Intergenic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1055815896 9:80206119-80206141 CCATCATGTTCGTTTGGTATTGG - Intergenic
1189599481 X:42607434-42607456 CCCTCATTTTCATTTTGTACTGG + Intergenic
1202141706 Y:21731193-21731215 CAGTCATGTTCAGGTTGTTCAGG - Intergenic
1202145159 Y:21772609-21772631 CAGTCATGTTCAGGTTGTTCAGG + Intergenic