ID: 917613604

View in Genome Browser
Species Human (GRCh38)
Location 1:176715057-176715079
Sequence CAGAGTTTCACCTAACAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917613604_917613613 29 Left 917613604 1:176715057-176715079 CCTACTTGTTAGGTGAAACTCTG 0: 1
1: 0
2: 3
3: 18
4: 105
Right 917613613 1:176715109-176715131 CTGCCACTATGACCTAGACCTGG 0: 1
1: 0
2: 2
3: 9
4: 95
917613604_917613605 -10 Left 917613604 1:176715057-176715079 CCTACTTGTTAGGTGAAACTCTG 0: 1
1: 0
2: 3
3: 18
4: 105
Right 917613605 1:176715070-176715092 TGAAACTCTGCCTCACTTAATGG 0: 1
1: 0
2: 1
3: 25
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917613604 Original CRISPR CAGAGTTTCACCTAACAAGT AGG (reversed) Intronic
900668265 1:3830899-3830921 CAGTGTTTCATCCAACAAATGGG - Intronic
904348319 1:29888467-29888489 TAGAGTTCCACTTAACTAGTAGG - Intergenic
906218583 1:44059600-44059622 GAGAGTTTCACTTAACAAATAGG - Intergenic
912465914 1:109873726-109873748 CAGAGTTTCCCCCAACTTGTTGG - Intergenic
914395104 1:147258707-147258729 CAGAGGTTCACCTTACAAGGAGG - Intronic
917613604 1:176715057-176715079 CAGAGTTTCACCTAACAAGTAGG - Intronic
920036491 1:203068925-203068947 CAGAGTCTCAGCTATGAAGTGGG - Intronic
923031643 1:230253702-230253724 CAGAGTTTCAAATAACCAGGAGG - Intronic
1066312939 10:34215318-34215340 CAGAGTTTCACATAAAACTTAGG - Intronic
1066439081 10:35420672-35420694 CAGACTCTCACCTAAAAAGTAGG + Intronic
1073891989 10:108112742-108112764 AAGAGTTTCATCTAGCAAGTAGG + Intergenic
1074335346 10:112568852-112568874 CTGAGTTTCACCTTTTAAGTGGG - Intronic
1074758474 10:116646238-116646260 CACACTTTCACCTATCAAATTGG - Intergenic
1077181786 11:1220188-1220210 CACAGTGACACCAAACAAGTGGG - Intergenic
1081339324 11:41907590-41907612 GAGAGTTCCACTTAAAAAGTAGG - Intergenic
1082980499 11:59116423-59116445 CAGAATTTCACCTTACCAGGAGG - Intronic
1083907880 11:65685888-65685910 GAGAGTTCCACCTAACAAGTTGG - Intergenic
1085538832 11:77246810-77246832 CAGCATTTCACCTAACACATGGG + Intronic
1086447290 11:86881141-86881163 CAGTCTTTCACCTATTAAGTAGG + Intronic
1086642454 11:89176528-89176550 CTGTGTTTCATCTATCAAGTTGG - Intergenic
1087670410 11:101099827-101099849 CACAGTTTTACACAACAAGTAGG - Intronic
1093528005 12:20125889-20125911 CAGAGCTTCAAGTAAGAAGTGGG - Intergenic
1097496897 12:60350921-60350943 CAGAGTTTCACCTGTCACCTAGG - Intergenic
1098069745 12:66659375-66659397 CAGAGTTTTATCTCACACGTAGG + Intronic
1098250499 12:68564408-68564430 GAGAGTCTCACCCAACAATTAGG - Intergenic
1098305387 12:69097539-69097561 TAGTGTTTGACCTAACAACTAGG + Intergenic
1098688729 12:73459418-73459440 CAGAGTTCCCCCTAGCAAGAAGG - Intergenic
1100090190 12:90958645-90958667 CATAGTTTCTCCTAGCAAGATGG + Intergenic
1101826320 12:108223208-108223230 CAATGTTTCACCAAACAACTGGG + Intronic
1104106397 12:125663927-125663949 CAGGGTTTCACTAAACATGTTGG - Intergenic
1105759076 13:23496648-23496670 CAGAGTTTAAGCGAACAAGCTGG - Intergenic
1108764287 13:53607590-53607612 CAGAGTTTCATCTAAGAGCTGGG - Intergenic
1110115766 13:71814920-71814942 CAGCACTTCAACTAACAAGTTGG + Intronic
1112554129 13:100451247-100451269 CAGTGTTTGACCTAACATCTGGG + Intronic
1116161218 14:41268769-41268791 GAGAGTTCCACCTAACAAGTAGG - Intergenic
1119755130 14:77112174-77112196 CAGAGTTTCACATCATCAGTGGG - Intronic
1120330515 14:83087286-83087308 CATAGTTTCAGCTAACAAAAAGG + Intergenic
1122502081 14:102207496-102207518 CACCGCTTCACCTAACAGGTGGG - Intronic
1122779652 14:104138366-104138388 CAGGGACTCACCTAACAGGTTGG + Intergenic
1124106471 15:26742329-26742351 CAGAGTTTAAACTAAAAATTGGG - Intronic
1125853261 15:42924468-42924490 CAGAGTTGCACATGAGAAGTGGG + Intergenic
1126702424 15:51380276-51380298 TAGGGTTTCACCTCACAAGGGGG - Intronic
1142838770 17:2610192-2610214 CAGACTTTCACCTGGCAAGTTGG + Intronic
1145259550 17:21346666-21346688 AAGGGTTTCACCCCACAAGTTGG + Intergenic
1145317067 17:21741282-21741304 AAGGGTTTCACCCCACAAGTTGG - Intergenic
1153106033 18:1528050-1528072 CAGAGTTACTCCAAACAAGTAGG + Intergenic
1155422964 18:25675535-25675557 AAGAGTTTCAACTAGCAATTGGG - Intergenic
1158852551 18:61509792-61509814 GAGGGTTTCACCTAAGTAGTGGG + Intronic
1158869718 18:61673816-61673838 CAGAGTTTCACCTCTGAAGTAGG + Intergenic
1159741445 18:72176260-72176282 CAGAGTTGGACCTCACAAATCGG - Intergenic
1163530903 19:17848247-17848269 CAGAGCCCCACTTAACAAGTGGG - Intergenic
1165250564 19:34530415-34530437 CAGAATTCCACCTAACATTTAGG - Intergenic
930473456 2:51849912-51849934 CAGGGTTTCATCTAAGAAGATGG - Intergenic
931933475 2:67167962-67167984 CACATTTTCACCTAACAAGGAGG - Intergenic
933296618 2:80498221-80498243 CAGACTTTCACAAAACCAGTGGG + Intronic
933595202 2:84276542-84276564 GAGAGTTTCACATCGCAAGTTGG + Intergenic
935646892 2:105344774-105344796 CAGGGTTTCACCAAACCTGTTGG + Intronic
936412425 2:112272436-112272458 CAGAGTTTCACTTCACAGGCTGG - Intergenic
940630508 2:156231958-156231980 AAGAGATTCACCTAACAAATAGG + Intergenic
940927129 2:159377007-159377029 GGGAGTTTAACCTCACAAGTTGG - Intronic
944402611 2:199345457-199345479 CACATTTTCACTTAAGAAGTTGG + Intronic
946547056 2:220755671-220755693 AAGAGCTTCACCTGAGAAGTGGG - Intergenic
946806163 2:223473247-223473269 GAGAGTTCCACATAACAAGTAGG + Intergenic
947292634 2:228594105-228594127 AAGATTTTCAGTTAACAAGTTGG + Intergenic
947351011 2:229245149-229245171 AAGAGTTTCACACAACAGGTGGG - Intronic
1170241525 20:14172227-14172249 CAGAGGCTCACCTAACAAAAAGG - Intronic
1173062550 20:39676034-39676056 CAGAGATTCAAGTAACAGGTGGG + Intergenic
1174684320 20:52438936-52438958 AAGAGATTCTCCTAACATGTTGG + Intergenic
1175070119 20:56325876-56325898 CAGAGTTTCACCTCAGACCTTGG - Intergenic
1177898574 21:26884879-26884901 CATAGTCTCACCTTGCAAGTGGG - Intergenic
949944741 3:9180939-9180961 CACAGTTTCTCCTATCCAGTGGG - Intronic
951833085 3:26951692-26951714 GAGAGTTTCATCTAACGAGTAGG + Intergenic
952693691 3:36240456-36240478 CTAAGTTTCACCCAACAAATTGG + Intergenic
953001798 3:38941001-38941023 CAGAGTTTCCCCTTAAAAGAAGG + Intronic
953492125 3:43361425-43361447 CAGAGTTTGTCCTAGCAAGTGGG - Intronic
957926352 3:86818034-86818056 AAAAGTTTCCCCTAACACGTAGG - Intergenic
958595577 3:96217510-96217532 GAGAATTTCACCTAGCAAGTAGG + Intergenic
960705681 3:120478459-120478481 CAAAGTTTCAATTAAAAAGTGGG + Intergenic
962472086 3:135718722-135718744 TAGTGTTTGACCTAACAACTGGG + Intergenic
964066138 3:152582172-152582194 CAGAGTGTCACCCTAGAAGTTGG + Intergenic
964186292 3:153947843-153947865 CATAGTTTCACATAAGAAGATGG - Intergenic
964641281 3:158912664-158912686 GAGCGTTCCACTTAACAAGTAGG + Intergenic
966999863 3:185323909-185323931 TATATTTTCACCTAACAAATTGG - Intronic
968695614 4:2024716-2024738 GAGAGTTCCACCTAACAAGTAGG + Intronic
971841711 4:31861544-31861566 CAGTTTTTCACCAAACCAGTGGG - Intergenic
972231302 4:37075465-37075487 CAGAGTTTCATCTAGAAAATGGG - Intergenic
972896958 4:43634293-43634315 CAGAGCATAACCTAACAATTAGG - Intergenic
973149149 4:46865900-46865922 GAGAATTCCACCTAACAAGTAGG - Intronic
974344733 4:60664599-60664621 AAGAGTTTCACCAAACAACTAGG + Intergenic
974849471 4:67387440-67387462 TAGATTTTCTCCCAACAAGTAGG + Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
975817597 4:78235243-78235265 TAGTGTTTGACCAAACAAGTGGG + Intronic
976962918 4:91001646-91001668 AAGAGACTCACCTAACACGTAGG - Intronic
981240457 4:142470379-142470401 CAGTATTTCATCTAACAAATTGG + Intronic
982358826 4:154496630-154496652 CAGTGTTTCACCAAACAATGTGG - Intergenic
985010272 4:185575322-185575344 CAGTTTTTCACCTAGCAAGTTGG - Intergenic
989719708 5:44510303-44510325 CAGAGTTTTACATAACATATAGG - Intergenic
990946836 5:61258330-61258352 CAAAGTATCACCTATCAAATTGG + Intergenic
991992518 5:72354605-72354627 CAGAGCCTCACCAACCAAGTTGG - Intronic
993175927 5:84485289-84485311 CAGATTTTCATTTCACAAGTTGG - Intergenic
995648379 5:114339463-114339485 CAGAGTTTAACATAAAATGTTGG + Intergenic
1000818048 5:165948276-165948298 CAGTGTTTGACCAAACAACTGGG - Intergenic
1003923735 6:10857336-10857358 TAGTGTTTGACCAAACAAGTGGG - Intronic
1006771084 6:36553565-36553587 TAGCGTTTGACCTAACAATTGGG + Intergenic
1007130048 6:39463834-39463856 CAGATTTTAACCAAATAAGTTGG + Intronic
1007263525 6:40580499-40580521 CAGAGATTCACCTATCACTTCGG - Intronic
1010423549 6:75701377-75701399 GAGAGTTCCAGCTATCAAGTAGG - Intronic
1012894513 6:104933209-104933231 CAGATTTTCAATTCACAAGTAGG - Intergenic
1016752435 6:147645841-147645863 CAAAGTTTCACCTAAAAACCTGG - Intronic
1017341742 6:153332014-153332036 CACAATTTCTCCCAACAAGTTGG - Intergenic
1019094500 6:169567814-169567836 CAGAGTTGCAGCTTCCAAGTTGG - Intronic
1021476534 7:21067709-21067731 CAGAGTTTGACCCATAAAGTTGG + Intergenic
1023087296 7:36583749-36583771 GAGAGGTTAACCTAACAGGTAGG - Intronic
1029161024 7:98552017-98552039 TTGAGTTTCAGCTAACAAGATGG + Intergenic
1037320638 8:17639152-17639174 AAGAGACTCACCTAACAAATAGG - Intronic
1039815646 8:41092400-41092422 GAGAGTTTCACCTCACACCTTGG + Intergenic
1042760867 8:72270156-72270178 GAGAGTCCCACCTCACAAGTAGG - Intergenic
1051120873 9:13750775-13750797 GAGAGTTTCACCTGACACTTTGG - Intergenic
1055095746 9:72412212-72412234 CAGTGTTTGACCAAACAAATGGG + Intergenic
1057000606 9:91505243-91505265 CAGAGTTTAACCAAAGAAGCAGG - Intergenic
1058937977 9:109786590-109786612 CAAAGTGTCACCTATCCAGTGGG - Intronic
1060096026 9:120791482-120791504 CTGAGTTTCACCCTTCAAGTTGG - Intronic
1193326195 X:80180953-80180975 GAGAGTTTCACTTAACATGTAGG - Intergenic
1194847037 X:98822585-98822607 CAGAGTTTCAGGCAACAAGTAGG - Intergenic
1196392791 X:115226231-115226253 CACAGTTTTACATAACAATTTGG + Intronic
1200222832 X:154400146-154400168 CAGTGTTTCCCCTAACCTGTGGG - Intronic
1201343713 Y:12960083-12960105 GAGGGTTTCACTTAGCAAGTAGG - Intergenic