ID: 917618185

View in Genome Browser
Species Human (GRCh38)
Location 1:176767792-176767814
Sequence TGACAGCACGTTTGGTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917618185_917618192 16 Left 917618185 1:176767792-176767814 CCAGCTGACCAAACGTGCTGTCA 0: 1
1: 0
2: 0
3: 5
4: 52
Right 917618192 1:176767831-176767853 TGAAGAAAATTATAGAATCCTGG 0: 1
1: 0
2: 1
3: 36
4: 671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917618185 Original CRISPR TGACAGCACGTTTGGTCAGC TGG (reversed) Intronic