ID: 917618187

View in Genome Browser
Species Human (GRCh38)
Location 1:176767800-176767822
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 562}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917618187_917618192 8 Left 917618187 1:176767800-176767822 CCAAACGTGCTGTCACCTCAGGC 0: 1
1: 0
2: 0
3: 41
4: 562
Right 917618192 1:176767831-176767853 TGAAGAAAATTATAGAATCCTGG 0: 1
1: 0
2: 1
3: 36
4: 671
917618187_917618194 28 Left 917618187 1:176767800-176767822 CCAAACGTGCTGTCACCTCAGGC 0: 1
1: 0
2: 0
3: 41
4: 562
Right 917618194 1:176767851-176767873 TGGTCGTGATCACAAGACAGTGG 0: 1
1: 0
2: 0
3: 6
4: 61
917618187_917618195 29 Left 917618187 1:176767800-176767822 CCAAACGTGCTGTCACCTCAGGC 0: 1
1: 0
2: 0
3: 41
4: 562
Right 917618195 1:176767852-176767874 GGTCGTGATCACAAGACAGTGGG 0: 1
1: 0
2: 1
3: 6
4: 43
917618187_917618196 30 Left 917618187 1:176767800-176767822 CCAAACGTGCTGTCACCTCAGGC 0: 1
1: 0
2: 0
3: 41
4: 562
Right 917618196 1:176767853-176767875 GTCGTGATCACAAGACAGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917618187 Original CRISPR GCCTGAGGTGACAGCACGTT TGG (reversed) Intronic