ID: 917618189

View in Genome Browser
Species Human (GRCh38)
Location 1:176767815-176767837
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917618189_917618194 13 Left 917618189 1:176767815-176767837 CCTCAGGCTGGTCCCATGAAGAA 0: 1
1: 0
2: 1
3: 13
4: 160
Right 917618194 1:176767851-176767873 TGGTCGTGATCACAAGACAGTGG 0: 1
1: 0
2: 0
3: 6
4: 61
917618189_917618195 14 Left 917618189 1:176767815-176767837 CCTCAGGCTGGTCCCATGAAGAA 0: 1
1: 0
2: 1
3: 13
4: 160
Right 917618195 1:176767852-176767874 GGTCGTGATCACAAGACAGTGGG 0: 1
1: 0
2: 1
3: 6
4: 43
917618189_917618196 15 Left 917618189 1:176767815-176767837 CCTCAGGCTGGTCCCATGAAGAA 0: 1
1: 0
2: 1
3: 13
4: 160
Right 917618196 1:176767853-176767875 GTCGTGATCACAAGACAGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 68
917618189_917618192 -7 Left 917618189 1:176767815-176767837 CCTCAGGCTGGTCCCATGAAGAA 0: 1
1: 0
2: 1
3: 13
4: 160
Right 917618192 1:176767831-176767853 TGAAGAAAATTATAGAATCCTGG 0: 1
1: 0
2: 1
3: 36
4: 671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917618189 Original CRISPR TTCTTCATGGGACCAGCCTG AGG (reversed) Intronic