ID: 917618190 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:176767827-176767849 |
Sequence | GATTCTATAATTTTCTTCAT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 491 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 50, 4: 440} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
917618190_917618195 | 2 | Left | 917618190 | 1:176767827-176767849 | CCCATGAAGAAAATTATAGAATC | 0: 1 1: 0 2: 0 3: 50 4: 440 |
||
Right | 917618195 | 1:176767852-176767874 | GGTCGTGATCACAAGACAGTGGG | 0: 1 1: 0 2: 1 3: 6 4: 43 |
||||
917618190_917618196 | 3 | Left | 917618190 | 1:176767827-176767849 | CCCATGAAGAAAATTATAGAATC | 0: 1 1: 0 2: 0 3: 50 4: 440 |
||
Right | 917618196 | 1:176767853-176767875 | GTCGTGATCACAAGACAGTGGGG | 0: 1 1: 0 2: 0 3: 4 4: 68 |
||||
917618190_917618194 | 1 | Left | 917618190 | 1:176767827-176767849 | CCCATGAAGAAAATTATAGAATC | 0: 1 1: 0 2: 0 3: 50 4: 440 |
||
Right | 917618194 | 1:176767851-176767873 | TGGTCGTGATCACAAGACAGTGG | 0: 1 1: 0 2: 0 3: 6 4: 61 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
917618190 | Original CRISPR | GATTCTATAATTTTCTTCAT GGG (reversed) | Intronic | ||