ID: 917618190

View in Genome Browser
Species Human (GRCh38)
Location 1:176767827-176767849
Sequence GATTCTATAATTTTCTTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 0, 3: 50, 4: 440}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917618190_917618195 2 Left 917618190 1:176767827-176767849 CCCATGAAGAAAATTATAGAATC 0: 1
1: 0
2: 0
3: 50
4: 440
Right 917618195 1:176767852-176767874 GGTCGTGATCACAAGACAGTGGG 0: 1
1: 0
2: 1
3: 6
4: 43
917618190_917618196 3 Left 917618190 1:176767827-176767849 CCCATGAAGAAAATTATAGAATC 0: 1
1: 0
2: 0
3: 50
4: 440
Right 917618196 1:176767853-176767875 GTCGTGATCACAAGACAGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 68
917618190_917618194 1 Left 917618190 1:176767827-176767849 CCCATGAAGAAAATTATAGAATC 0: 1
1: 0
2: 0
3: 50
4: 440
Right 917618194 1:176767851-176767873 TGGTCGTGATCACAAGACAGTGG 0: 1
1: 0
2: 0
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917618190 Original CRISPR GATTCTATAATTTTCTTCAT GGG (reversed) Intronic