ID: 917618191

View in Genome Browser
Species Human (GRCh38)
Location 1:176767828-176767850
Sequence GGATTCTATAATTTTCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 523}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917618191_917618195 1 Left 917618191 1:176767828-176767850 CCATGAAGAAAATTATAGAATCC 0: 1
1: 0
2: 2
3: 27
4: 523
Right 917618195 1:176767852-176767874 GGTCGTGATCACAAGACAGTGGG 0: 1
1: 0
2: 1
3: 6
4: 43
917618191_917618194 0 Left 917618191 1:176767828-176767850 CCATGAAGAAAATTATAGAATCC 0: 1
1: 0
2: 2
3: 27
4: 523
Right 917618194 1:176767851-176767873 TGGTCGTGATCACAAGACAGTGG 0: 1
1: 0
2: 0
3: 6
4: 61
917618191_917618196 2 Left 917618191 1:176767828-176767850 CCATGAAGAAAATTATAGAATCC 0: 1
1: 0
2: 2
3: 27
4: 523
Right 917618196 1:176767853-176767875 GTCGTGATCACAAGACAGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917618191 Original CRISPR GGATTCTATAATTTTCTTCA TGG (reversed) Intronic