ID: 917618191 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:176767828-176767850 |
| Sequence | GGATTCTATAATTTTCTTCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 553 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 27, 4: 523} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 917618191_917618195 | 1 | Left | 917618191 | 1:176767828-176767850 | CCATGAAGAAAATTATAGAATCC | 0: 1 1: 0 2: 2 3: 27 4: 523 |
||
| Right | 917618195 | 1:176767852-176767874 | GGTCGTGATCACAAGACAGTGGG | 0: 1 1: 0 2: 1 3: 6 4: 43 |
||||
| 917618191_917618194 | 0 | Left | 917618191 | 1:176767828-176767850 | CCATGAAGAAAATTATAGAATCC | 0: 1 1: 0 2: 2 3: 27 4: 523 |
||
| Right | 917618194 | 1:176767851-176767873 | TGGTCGTGATCACAAGACAGTGG | 0: 1 1: 0 2: 0 3: 6 4: 61 |
||||
| 917618191_917618196 | 2 | Left | 917618191 | 1:176767828-176767850 | CCATGAAGAAAATTATAGAATCC | 0: 1 1: 0 2: 2 3: 27 4: 523 |
||
| Right | 917618196 | 1:176767853-176767875 | GTCGTGATCACAAGACAGTGGGG | 0: 1 1: 0 2: 0 3: 4 4: 68 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 917618191 | Original CRISPR | GGATTCTATAATTTTCTTCA TGG (reversed) | Intronic | ||