ID: 917618192

View in Genome Browser
Species Human (GRCh38)
Location 1:176767831-176767853
Sequence TGAAGAAAATTATAGAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 709
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 671}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917618189_917618192 -7 Left 917618189 1:176767815-176767837 CCTCAGGCTGGTCCCATGAAGAA 0: 1
1: 0
2: 1
3: 13
4: 160
Right 917618192 1:176767831-176767853 TGAAGAAAATTATAGAATCCTGG 0: 1
1: 0
2: 1
3: 36
4: 671
917618185_917618192 16 Left 917618185 1:176767792-176767814 CCAGCTGACCAAACGTGCTGTCA 0: 1
1: 0
2: 0
3: 5
4: 52
Right 917618192 1:176767831-176767853 TGAAGAAAATTATAGAATCCTGG 0: 1
1: 0
2: 1
3: 36
4: 671
917618187_917618192 8 Left 917618187 1:176767800-176767822 CCAAACGTGCTGTCACCTCAGGC 0: 1
1: 0
2: 0
3: 41
4: 562
Right 917618192 1:176767831-176767853 TGAAGAAAATTATAGAATCCTGG 0: 1
1: 0
2: 1
3: 36
4: 671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917618192 Original CRISPR TGAAGAAAATTATAGAATCC TGG Intronic