ID: 917618194

View in Genome Browser
Species Human (GRCh38)
Location 1:176767851-176767873
Sequence TGGTCGTGATCACAAGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917618191_917618194 0 Left 917618191 1:176767828-176767850 CCATGAAGAAAATTATAGAATCC 0: 1
1: 0
2: 2
3: 27
4: 523
Right 917618194 1:176767851-176767873 TGGTCGTGATCACAAGACAGTGG 0: 1
1: 0
2: 0
3: 6
4: 61
917618190_917618194 1 Left 917618190 1:176767827-176767849 CCCATGAAGAAAATTATAGAATC 0: 1
1: 0
2: 0
3: 50
4: 440
Right 917618194 1:176767851-176767873 TGGTCGTGATCACAAGACAGTGG 0: 1
1: 0
2: 0
3: 6
4: 61
917618189_917618194 13 Left 917618189 1:176767815-176767837 CCTCAGGCTGGTCCCATGAAGAA 0: 1
1: 0
2: 1
3: 13
4: 160
Right 917618194 1:176767851-176767873 TGGTCGTGATCACAAGACAGTGG 0: 1
1: 0
2: 0
3: 6
4: 61
917618187_917618194 28 Left 917618187 1:176767800-176767822 CCAAACGTGCTGTCACCTCAGGC 0: 1
1: 0
2: 0
3: 41
4: 562
Right 917618194 1:176767851-176767873 TGGTCGTGATCACAAGACAGTGG 0: 1
1: 0
2: 0
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917618194 Original CRISPR TGGTCGTGATCACAAGACAG TGG Intronic