ID: 917618194

View in Genome Browser
Species Human (GRCh38)
Location 1:176767851-176767873
Sequence TGGTCGTGATCACAAGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917618191_917618194 0 Left 917618191 1:176767828-176767850 CCATGAAGAAAATTATAGAATCC 0: 1
1: 0
2: 2
3: 27
4: 523
Right 917618194 1:176767851-176767873 TGGTCGTGATCACAAGACAGTGG 0: 1
1: 0
2: 0
3: 6
4: 61
917618189_917618194 13 Left 917618189 1:176767815-176767837 CCTCAGGCTGGTCCCATGAAGAA 0: 1
1: 0
2: 1
3: 13
4: 160
Right 917618194 1:176767851-176767873 TGGTCGTGATCACAAGACAGTGG 0: 1
1: 0
2: 0
3: 6
4: 61
917618187_917618194 28 Left 917618187 1:176767800-176767822 CCAAACGTGCTGTCACCTCAGGC 0: 1
1: 0
2: 0
3: 41
4: 562
Right 917618194 1:176767851-176767873 TGGTCGTGATCACAAGACAGTGG 0: 1
1: 0
2: 0
3: 6
4: 61
917618190_917618194 1 Left 917618190 1:176767827-176767849 CCCATGAAGAAAATTATAGAATC 0: 1
1: 0
2: 0
3: 50
4: 440
Right 917618194 1:176767851-176767873 TGGTCGTGATCACAAGACAGTGG 0: 1
1: 0
2: 0
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917618194 Original CRISPR TGGTCGTGATCACAAGACAG TGG Intronic
900716179 1:4146208-4146230 TGGTCTTGATCTCAAGTCACCGG + Intergenic
905841258 1:41180978-41181000 TGGTAGTGATACCAAAACAGAGG + Intronic
910098716 1:83554098-83554120 TGGTAGTTATCACTAGGCAGTGG + Intergenic
911256933 1:95644091-95644113 TGTTAGAGATCTCAAGACAGAGG - Intergenic
916364863 1:164014617-164014639 TCTTCATGATCACAACACAGTGG + Intergenic
917618194 1:176767851-176767873 TGGTCGTGATCACAAGACAGTGG + Intronic
1067733341 10:48829944-48829966 TGGTTTTGATTACAACACAGAGG + Intronic
1068835525 10:61548333-61548355 TGGTCATCATCACAAGATTGAGG + Intergenic
1069670830 10:70201663-70201685 TGGTGGTGTGCAGAAGACAGGGG + Intergenic
1079987829 11:27216800-27216822 TGGCCTTGGTCACAAGACAAGGG - Intergenic
1080072753 11:28109233-28109255 TGTTTCTGATCACTAGACAGAGG + Intronic
1081007133 11:37758709-37758731 TGGTAGTGATTACAGAACAGAGG + Intergenic
1081701165 11:45153660-45153682 TGGCCTTGAACACAAGACAGTGG - Intronic
1084579867 11:70016508-70016530 TGATTGTGGTCACAGGACAGTGG + Intergenic
1089140849 11:116282658-116282680 TGGTAGTGATCATAAGAGACAGG + Intergenic
1093839182 12:23875051-23875073 AGGTTATGACCACAAGACAGTGG + Intronic
1113887702 13:113669773-113669795 TGATGGTCATCACCAGACAGAGG - Exonic
1124088951 15:26579496-26579518 TGGTTGTCATCACAGGACTGGGG + Intronic
1124664941 15:31584324-31584346 TGGCAGTGATCACAAGACTGGGG + Intronic
1127110201 15:55661072-55661094 TGGGCATGATCAAAAGATAGGGG - Intronic
1128283728 15:66418606-66418628 TGGTGGTGACCACTAAACAGTGG - Intronic
1129171964 15:73813436-73813458 TTGTCATGAGCAGAAGACAGAGG - Intergenic
1130266172 15:82405950-82405972 TGGAATTGATCACAAGACACAGG - Intergenic
1138614807 16:58156941-58156963 TGGTCCTCAGCTCAAGACAGTGG - Intergenic
1144486994 17:15674824-15674846 GGGGGGTGATCACAAAACAGTGG + Intronic
1144914034 17:18707476-18707498 GGGGGGTGATCACAAAACAGTGG - Intronic
1146224204 17:31051697-31051719 GGGTGGTGATTACAAGAAAGTGG - Intergenic
1149218973 17:54392832-54392854 TGGTCGTGTTCTCATGGCAGTGG - Intergenic
1151760598 17:76100177-76100199 TGGTGGTTACCAGAAGACAGAGG + Intronic
1154990586 18:21594764-21594786 TTGTTGTTATCACAAGACACTGG - Intronic
1156468669 18:37363844-37363866 GGGTCCTGAGCATAAGACAGGGG - Intronic
1158842046 18:61397659-61397681 TGTTCTTAACCACAAGACAGAGG - Intronic
1164908644 19:31987670-31987692 GAGTCGGGATCACAAGCCAGTGG - Intergenic
1168204013 19:54836109-54836131 TGATCGTGGTCACAGGTCAGAGG + Intronic
930065501 2:47324558-47324580 TGGTCTTGATCCTAAGACAGTGG + Intergenic
931894892 2:66717734-66717756 TGGTCCTGCTCTCATGACAGAGG - Intergenic
932534544 2:72579205-72579227 TGGCCGTGATGACTAAACAGTGG + Intronic
932555743 2:72824002-72824024 TGGTCCTGATCATAAGGCAATGG + Intronic
933066360 2:77803529-77803551 TGGTCTTGATCATTACACAGTGG - Intergenic
1173334462 20:42101527-42101549 TGGACCTGATGACAAGAAAGTGG + Intronic
952915546 3:38236862-38236884 TGGGCGTCTTCATAAGACAGAGG + Exonic
956198918 3:66684731-66684753 GGGTGGTGATCCCAAGAGAGTGG - Intergenic
964850179 3:161087697-161087719 TGTTCCTGATCTCAAGGCAGAGG + Intronic
969744495 4:9059469-9059491 GGGTCGTGATCATGAGAGAGTGG - Intergenic
969893556 4:10281768-10281790 TGGTCATGTAGACAAGACAGTGG + Intergenic
972030504 4:34451201-34451223 TAGTATTGATCAGAAGACAGTGG - Intergenic
980929862 4:139175765-139175787 TGTTCATGAACACAAGAAAGGGG + Intronic
982687974 4:158514745-158514767 TGATGGTTATCACAAGTCAGTGG - Intronic
985807866 5:2060379-2060401 TGTTCCTGAACACCAGACAGCGG + Intergenic
987617231 5:20291979-20292001 TGGACATGATGACATGACAGAGG - Intronic
997811869 5:136978637-136978659 TGGTAGTGCCCACAAGAAAGAGG - Exonic
1000855054 5:166387914-166387936 TGGTCCTGATAAAAAGCCAGAGG + Intergenic
1003714552 6:8632001-8632023 AGGTTGTGATCACAAGAGAGAGG - Intergenic
1006939462 6:37742413-37742435 TGGTTGTGAACAGAGGACAGAGG + Intergenic
1008416280 6:51244576-51244598 TGGTCCTGATGAGAAGATAGGGG - Intergenic
1016647243 6:146424360-146424382 TGGTAGTGATTTCTAGACAGGGG + Intronic
1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG + Intronic
1022528156 7:31051754-31051776 TGGTGGTGCTTACAGGACAGAGG - Intergenic
1024391019 7:48812598-48812620 TGGTCATCAACACAAGACAGGGG - Intergenic
1026977615 7:74508031-74508053 TGGTGGTGGGCACAAGGCAGGGG - Intronic
1027338562 7:77181153-77181175 TGGGGTTGATCAGAAGACAGAGG + Intronic
1027629547 7:80585530-80585552 TGGAGGTGATCAGAAGACAATGG - Intronic
1035411303 7:158644761-158644783 TGGTGGTGATCTCAATGCAGGGG + Intronic
1047232513 8:123009465-123009487 TGGCCGTGATGACATGGCAGGGG + Intergenic
1051068309 9:13131721-13131743 TGCTGGTGGCCACAAGACAGTGG - Intronic
1051135280 9:13913133-13913155 TGGTCTAGGTCACAGGACAGTGG - Intergenic
1058539309 9:105995110-105995132 TGGTCTTGTTCACATGACAGTGG - Intergenic
1190185927 X:48234227-48234249 AGGGCGAGATCACAAGACTGGGG - Intronic