ID: 917618196

View in Genome Browser
Species Human (GRCh38)
Location 1:176767853-176767875
Sequence GTCGTGATCACAAGACAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917618190_917618196 3 Left 917618190 1:176767827-176767849 CCCATGAAGAAAATTATAGAATC 0: 1
1: 0
2: 0
3: 50
4: 440
Right 917618196 1:176767853-176767875 GTCGTGATCACAAGACAGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 68
917618189_917618196 15 Left 917618189 1:176767815-176767837 CCTCAGGCTGGTCCCATGAAGAA 0: 1
1: 0
2: 1
3: 13
4: 160
Right 917618196 1:176767853-176767875 GTCGTGATCACAAGACAGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 68
917618191_917618196 2 Left 917618191 1:176767828-176767850 CCATGAAGAAAATTATAGAATCC 0: 1
1: 0
2: 2
3: 27
4: 523
Right 917618196 1:176767853-176767875 GTCGTGATCACAAGACAGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 68
917618187_917618196 30 Left 917618187 1:176767800-176767822 CCAAACGTGCTGTCACCTCAGGC 0: 1
1: 0
2: 0
3: 41
4: 562
Right 917618196 1:176767853-176767875 GTCGTGATCACAAGACAGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917618196 Original CRISPR GTCGTGATCACAAGACAGTG GGG Intronic