ID: 917619546

View in Genome Browser
Species Human (GRCh38)
Location 1:176782084-176782106
Sequence AGCATTCAGGTTTCTACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917619546_917619550 2 Left 917619546 1:176782084-176782106 CCATTGGTAGAAACCTGAATGCT 0: 1
1: 0
2: 2
3: 7
4: 137
Right 917619550 1:176782109-176782131 CATTTTATAATATAGGCATTTGG 0: 1
1: 0
2: 3
3: 39
4: 383
917619546_917619548 -5 Left 917619546 1:176782084-176782106 CCATTGGTAGAAACCTGAATGCT 0: 1
1: 0
2: 2
3: 7
4: 137
Right 917619548 1:176782102-176782124 ATGCTTCCATTTTATAATATAGG 0: 1
1: 0
2: 1
3: 37
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917619546 Original CRISPR AGCATTCAGGTTTCTACCAA TGG (reversed) Intronic
908054593 1:60269879-60269901 AGCTTTCATGTATTTACCAATGG + Intergenic
910629945 1:89344173-89344195 AGCAGTCAGATTTCTCCCAGAGG - Intergenic
912864368 1:113244251-113244273 TGCATTCAGATTTCTAACATGGG + Intergenic
915792423 1:158688451-158688473 GGCATTCAGGTTGGTTCCAAAGG - Intergenic
917619546 1:176782084-176782106 AGCATTCAGGTTTCTACCAATGG - Intronic
917832537 1:178908232-178908254 TGCATTCATGTTGCTGCCAAGGG + Intronic
918662326 1:187105093-187105115 AAACTTCAGGTTTCTGCCAATGG - Intergenic
919707282 1:200689703-200689725 AGCTTTCAGTTTTATACCGAGGG + Intergenic
1062762189 10:31889-31911 AGCATGCAGGTTTGTTCCATAGG - Intergenic
1064370762 10:14750123-14750145 AGCCTTGAGGATGCTACCAATGG - Intronic
1065414413 10:25468979-25469001 ACCTTTCAGGTCTCTGCCAAGGG - Intronic
1066070039 10:31798830-31798852 GGCAATCAGGTTTCTAAGAATGG - Intergenic
1067456821 10:46425137-46425159 AGCACTCAGTTTCCTAACAATGG + Intergenic
1067630380 10:47959502-47959524 AGCACTCAGTTTCCTAACAATGG - Intergenic
1068375779 10:56178338-56178360 AGCATTCAAGTTGATACCACTGG - Intergenic
1068550241 10:58399927-58399949 GTCATTCAGGTTACTACAAATGG - Intergenic
1069071456 10:63994270-63994292 AACATTCCAGTTTCTACCTAAGG - Intergenic
1070272745 10:74973389-74973411 AGCATTAAGGTGTTTACGAATGG + Intronic
1071893366 10:90037444-90037466 AGCAATCAAGTTGCTACCAGGGG + Intergenic
1073850303 10:107608970-107608992 AGCATTTTGATTTCTACAAAGGG - Intergenic
1074867024 10:117550681-117550703 AGCAGCCAGGTTTCTACAGAGGG - Intergenic
1076122483 10:127947467-127947489 AGAATTCAGGTTTGTCCCATGGG + Intronic
1078613288 11:12840851-12840873 AGCAATAAAGTTACTACCAATGG - Intronic
1079849990 11:25520478-25520500 AGCTTTCAGGATTGTACCCATGG + Intergenic
1080202600 11:29690396-29690418 GGGATTCAGGTTTTTACCTAGGG + Intergenic
1081099382 11:38982998-38983020 AGCACTCTGCTTTCCACCAAAGG + Intergenic
1083005008 11:59335800-59335822 GGCATCAAGGTTGCTACCAATGG - Intergenic
1083148784 11:60777063-60777085 AGCACTTAGGTTTGTACTAAGGG - Intergenic
1084395709 11:68908524-68908546 AGCAATCAGGGCTCTGCCAAGGG - Exonic
1088410918 11:109533608-109533630 AGCCATCAGCTTTCTAACAATGG - Intergenic
1092573632 12:9753998-9754020 AAAATTCAGGTTTCTAGAAAAGG - Intronic
1095310876 12:40694875-40694897 AGCATGCATGTTTCTATCATGGG + Intronic
1097325501 12:58271844-58271866 AGCTTTTAGTTTTATACCAAGGG + Intergenic
1101601887 12:106216805-106216827 AGCATGCAGGTTTGTTACAAAGG + Intergenic
1101850587 12:108399018-108399040 ATCAGTCAGGTTTCAACCAGAGG - Intergenic
1102916925 12:116761030-116761052 AACATTCAGGGATCTACCCAGGG - Intronic
1107778578 13:43875016-43875038 TGCTTCTAGGTTTCTACCAAAGG + Intronic
1109151813 13:58857221-58857243 GGCAGTCAGGTTTCTCCCAAAGG + Intergenic
1113919229 13:113897491-113897513 AACATCCAGGTTTCCACCATTGG + Intergenic
1115248342 14:31319739-31319761 AGGATTCAGGTTTCTATTACTGG - Intronic
1115978421 14:39022108-39022130 AGCTTTCAGCTTTCTACATATGG - Intergenic
1116698339 14:48203894-48203916 AACATTCAGGTTTCTTACATAGG - Intergenic
1132231871 15:100190464-100190486 GGCATTCAGGTTTCTTCCAGAGG + Intronic
1132559665 16:587618-587640 AGAAGTCAGGTTTCTCCCACTGG - Intergenic
1133661109 16:7918737-7918759 AGCATTCAGCATTCCAACAAAGG - Intergenic
1138681659 16:58688031-58688053 AGCATTCAGGATTCAAGCAGTGG - Intergenic
1139277650 16:65742851-65742873 ACCAGTCAGGTTTCCTCCAAGGG - Intergenic
1144254905 17:13458194-13458216 AGCATTCAGCTTGTTACCGAGGG + Intergenic
1146141387 17:30371051-30371073 CCCTTTCAGGTTTCTCCCAAGGG - Intergenic
1148019444 17:44543483-44543505 AGCATTCAGGCTCCTCCCAAGGG + Intergenic
1148719767 17:49743203-49743225 ATCATCCTGGTTTCTAGCAAGGG - Intronic
1151968886 17:77447074-77447096 AGCATTCTGGTGGCTGCCAAGGG - Intronic
1152955099 18:32219-32241 AGCATGCAGGTTTGTTCCATAGG - Intergenic
1157312469 18:46562402-46562424 AACATTCATGTTTCTCCTAAGGG + Intronic
1158203922 18:54970029-54970051 AGCATCCAGGTCTCTAGAAAAGG + Intergenic
1158254752 18:55533281-55533303 AGCACTCTGGCTTCTATCAAAGG + Intronic
1159473446 18:68886511-68886533 AGAATTTAGGTTTCTACTTAAGG - Intronic
1159963977 18:74578402-74578424 AGCAGTGAGGTTGCTACCATTGG + Intronic
1164486541 19:28660897-28660919 ATGATTCAGTTTTCTCCCAATGG - Intergenic
926517193 2:13862596-13862618 AGCATGCAGGTTGTTACAAAGGG - Intergenic
926940092 2:18126483-18126505 AGAATTTTGGTTTTTACCAAAGG + Intronic
927938735 2:27090224-27090246 AGCATTGAGGTTTCTAAGAAAGG - Intronic
929034004 2:37673170-37673192 AGAATCCAGGTATCTGCCAAAGG - Intronic
930914404 2:56669707-56669729 TGCATCCATGTTTCTGCCAAGGG + Intergenic
931914578 2:66939637-66939659 ACCATTGAGGTTTCTGCCATTGG + Intergenic
932656042 2:73611887-73611909 AGAATGCAGGTTTTGACCAAAGG + Intergenic
934738019 2:96699782-96699804 AGGATGCAGGCTTCTCCCAAGGG - Intergenic
937346895 2:121131778-121131800 AGCGTTCAAGTTTCTTCCCACGG - Intergenic
937659770 2:124417444-124417466 AGCATTCATGTTTCCTGCAAAGG - Exonic
937702973 2:124885003-124885025 ATCAGTCAGGGTTCAACCAATGG + Intronic
937745559 2:125408780-125408802 TGCTTTCAGGTGTCTACCACAGG - Intergenic
938032533 2:128007804-128007826 AGCCTTCAGGTGTCTATCCAGGG - Intronic
938753928 2:134362560-134362582 AGCATTTGGGTTTCTAACCAAGG + Intronic
940269993 2:151880204-151880226 AGCATTCTTCTTTCTATCAAAGG + Intronic
940458901 2:153937486-153937508 AGGATTGAGGGTTCTAGCAAAGG + Intronic
943008346 2:182414581-182414603 GGCATTCTGGTTTCTGTCAAGGG + Intronic
943317390 2:186407017-186407039 ACCAAGCAGGTTTCTACCACAGG + Intergenic
944067815 2:195637687-195637709 AGGATTCAGGTTTTAAACAAGGG + Intronic
944381985 2:199121452-199121474 AGTATTCATGTTTTCACCAAAGG + Intergenic
946607745 2:221424394-221424416 AGCTTTCAGGATACAACCAAGGG + Intronic
1170216322 20:13895647-13895669 AGCATTCAGTTTTTTACCATTGG - Intronic
1170698415 20:18681433-18681455 ATCATTCAGGTTTATCCCATTGG + Intronic
949515707 3:4805021-4805043 GGCATTGGGGTTTCTATCAAAGG + Intronic
951392371 3:22122161-22122183 AGCAGTCAGATTTTTACCCAAGG - Intronic
957487849 3:80886142-80886164 AGCATTCAGTGATCTACAAATGG + Intergenic
959014845 3:101121936-101121958 AGCATTTAGATTTTAACCAAAGG + Intergenic
959633611 3:108536599-108536621 GCCACTCAGGGTTCTACCAAGGG + Intergenic
963912890 3:150829845-150829867 AACATTCAAGTTCCTCCCAATGG - Intergenic
966732374 3:183161939-183161961 AGCATTCATGTTACAAGCAAGGG + Intronic
969080432 4:4613702-4613724 AGCATTCAGCGCTCTACCAGTGG - Intergenic
972236327 4:37138047-37138069 AGCAGTGATGTTTCTACCAGAGG + Intergenic
975831357 4:78372549-78372571 AGCATTCAGGCTACTACAAGTGG + Intronic
979716300 4:123842909-123842931 AGCCTTCAGGTCTCACCCAAGGG + Intergenic
980404673 4:132341320-132341342 TATATTCAGGTTTCTTCCAATGG + Intergenic
980415304 4:132480650-132480672 TGCATACAGGTTTGTTCCAATGG + Intergenic
982471372 4:155794601-155794623 AGCATAAAGGATTTTACCAATGG - Intronic
982495914 4:156091995-156092017 AGCAAGCAGGCTTCTACCACAGG - Intergenic
984600485 4:181721085-181721107 AGCATTCAGATAAATACCAAGGG + Intergenic
984798587 4:183690397-183690419 AGCTTTCATGTTTCTATCTATGG - Intronic
984859331 4:184222546-184222568 AGCTTTCAGCTTTCCACCACTGG - Intergenic
990115357 5:52382987-52383009 ATCAATTAGGTTTCTAACAAAGG - Intergenic
990730363 5:58801859-58801881 AGCTTTCAGCTTTCTAGCTATGG + Intronic
994336942 5:98577747-98577769 TGCATGCAGGTGTCTACCACAGG - Intergenic
996861545 5:128072634-128072656 AAAACACAGGTTTCTACCAATGG + Intergenic
1005169960 6:22972008-22972030 AGTATTCAGCTTTGTATCAAGGG + Intergenic
1008059539 6:46982932-46982954 ATCATTTAGGTGCCTACCAAGGG - Intergenic
1008599475 6:53076696-53076718 AGCATTTTGGTATCTACAAAGGG - Intronic
1012677958 6:102140740-102140762 AACATTCAAATTTCTACCTAAGG - Intergenic
1013034672 6:106369436-106369458 AGAATTTAGGTTTATTCCAAAGG + Intergenic
1015138538 6:129902523-129902545 AACATCCATATTTCTACCAATGG + Intergenic
1015250815 6:131125686-131125708 AGAATTCAGGTTTGAACAAAGGG - Intergenic
1015334097 6:132016037-132016059 ACCATTCAAGTTTTTACAAAAGG - Intergenic
1016581341 6:145632013-145632035 AGTCTTTAAGTTTCTACCAAAGG - Intronic
1018206752 6:161443739-161443761 AGCACACTTGTTTCTACCAAAGG - Intronic
1019828891 7:3306097-3306119 AGCAATCAGATCTGTACCAAAGG + Intronic
1020874889 7:13680876-13680898 ACCATGTGGGTTTCTACCAAAGG - Intergenic
1021897791 7:25253559-25253581 AGCATCCATATTTCTATCAATGG - Intergenic
1023127066 7:36965112-36965134 AGCATCCTGGTTTCTTCCACAGG + Intronic
1025713802 7:63934758-63934780 AGCAATCATGTTTCTCTCAAGGG - Intergenic
1029916650 7:104216555-104216577 AGCATTTAGGTTTCTGACATAGG + Intergenic
1031095485 7:117414530-117414552 AGCATGCAGGTTTGTTCCATTGG + Intronic
1031805602 7:126303180-126303202 AGGATTCTGGTTACTACCCATGG + Intergenic
1032779365 7:135151299-135151321 TGGACTCATGTTTCTACCAAAGG + Intronic
1033499810 7:141936539-141936561 AGAACTCAGGTTTCAACCACTGG - Intronic
1036002974 8:4629869-4629891 AGCATTCAGATTTACACAAAGGG - Intronic
1041425763 8:57718662-57718684 TGCTTTCAAGTTTCTACCACAGG + Intergenic
1041971348 8:63746601-63746623 AGCATTCAGGTGGCTAGGAAAGG - Intergenic
1044108849 8:88246585-88246607 AGCATTCAGTTATCTACTGAAGG - Intronic
1044619159 8:94172188-94172210 ATTATTCAGGTTACTCCCAAAGG - Intronic
1046261975 8:111780484-111780506 AGCATTCAGATTTGTACCCATGG + Intergenic
1046693421 8:117311429-117311451 AGCATTTAGCTTGCTACAAAGGG + Intergenic
1047015898 8:120722959-120722981 AGGTTTCAGGTTTCTACATATGG + Intronic
1059443543 9:114324398-114324420 AACATACAGGCTTCTACCATTGG - Intronic
1059444735 9:114331173-114331195 AACATACAGGCTTCTACCATTGG - Intronic
1059569113 9:115415411-115415433 AGAATTCAGGTCTCTTCCAATGG + Intergenic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1186557698 X:10577218-10577240 AGCATTCAGCCTTCTGCCACAGG - Intronic
1191688618 X:63917863-63917885 AGCAACCAAGTTTCTCCCAAAGG - Intergenic
1193239269 X:79147396-79147418 ACACTTCAGGTTTCTCCCAAAGG + Intergenic
1195173912 X:102296573-102296595 AGCATTCATATTTCTACCAACGG - Intergenic
1195184953 X:102390520-102390542 AGCATTCATATTTCTACCAACGG + Intronic
1196199019 X:112864584-112864606 GACATTCAGATTTCTACTAATGG - Intergenic
1197535995 X:127690001-127690023 AGCACTCAAGTTTGTACCACTGG + Intergenic
1197809772 X:130430779-130430801 AGCCTTCAGGTTTCAAGCAGCGG + Intergenic
1199372765 X:147070724-147070746 AGCATTCAGGTTACTTTAAAGGG + Intergenic
1199519439 X:148718942-148718964 AGTATTCAGGTGTCTAAGAATGG + Intronic
1201974225 Y:19830967-19830989 AGCATCCAGGATTCCACCCAGGG + Intergenic