ID: 917620271

View in Genome Browser
Species Human (GRCh38)
Location 1:176788436-176788458
Sequence GGTGTAATGAGACTAGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 2, 3: 174, 4: 316}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917620271 Original CRISPR GGTGTAATGAGACTAGAAAA TGG Intronic
900907990 1:5574324-5574346 GGTTTATTGAAACTAGAGAATGG + Intergenic
902752056 1:18523469-18523491 GGAGAATTGAGACTAGAAAGGGG + Intergenic
904157279 1:28494764-28494786 GGTGAAAATAAACTAGAAAATGG + Intronic
905751820 1:40472014-40472036 GGTTTATTGAGACTAGAGAATGG - Intergenic
906330363 1:44879103-44879125 GGAATAATAAGACTAGGAAAAGG - Intronic
907254584 1:53168960-53168982 GGTTTATTGAGACTAGAGAACGG + Intergenic
908024766 1:59938877-59938899 GGTTTATCGAGACTAGAGAATGG + Intergenic
908238785 1:62171698-62171720 GGTTTATCGAGACTAGAGAATGG + Intergenic
908317272 1:62945354-62945376 GGTGTAATGAAACTGAACAATGG - Intergenic
908575808 1:65458798-65458820 GGTATAATGGGACTAACAAAAGG - Intronic
909359736 1:74746371-74746393 GGTATAATGAGACTAAAATAAGG - Intronic
909418890 1:75440192-75440214 GGTGCAAATAGAATAGAAAAGGG + Intronic
910322016 1:85956921-85956943 GACATAATGAAACTAGAAAACGG + Intronic
912814413 1:112817497-112817519 GGTTTATTGAGACTAGAGAATGG + Intergenic
914441348 1:147710127-147710149 GGTTTATTGAGACTAGAGAATGG + Intergenic
914773101 1:150709470-150709492 GGTTTATTGAGACTAGAGAATGG - Intronic
915052369 1:153088970-153088992 GGTTTACTGAGACTAGAGAATGG + Intergenic
916106171 1:161434184-161434206 GGTTTATTGAGACTAGAGAATGG - Intergenic
916156709 1:161857171-161857193 GTTGAAATGAGAAAAGAAAAAGG - Intronic
917620271 1:176788436-176788458 GGTGTAATGAGACTAGAAAATGG + Intronic
917646910 1:177038229-177038251 AGTGCAGTGAGACTAGAGAAGGG - Intronic
918000201 1:180486651-180486673 GGTGAAATCTGACTAGGAAAAGG + Intronic
918434124 1:184494076-184494098 AGTGTCATGAGAATACAAAAGGG + Intronic
919128198 1:193422275-193422297 GGGGGAATGAGACAAGTAAAAGG - Intergenic
922215110 1:223513802-223513824 GGTGTAATGAGATGATAAAATGG - Intergenic
922484871 1:225966113-225966135 GGTTTATTGAGACTAGAGAATGG - Intergenic
923440349 1:234012533-234012555 GGTTTATCGAGACTAGAGAATGG + Intronic
923725834 1:236504782-236504804 GGTTTATTGAGACTAGAGAATGG - Intergenic
924107240 1:240661297-240661319 TGTGTAATGAGAATAGCAGAAGG - Intergenic
924262248 1:242244035-242244057 TTTGTTATGAGACTTGAAAAAGG - Intronic
924953679 1:248907620-248907642 TGTTTATTGAGACTAGAGAATGG + Intronic
1063629551 10:7721172-7721194 GGGGAAATGAGACTCAAAAAGGG - Intronic
1065377979 10:25062035-25062057 TGTGTAAAGTGACTAGTAAATGG - Intronic
1065809317 10:29426995-29427017 GGTTTATTGAGACTAGAGAATGG - Intergenic
1066175042 10:32894740-32894762 GGTTTATTGAGACTAGAGAATGG - Intergenic
1066436547 10:35401208-35401230 GGTTTAATAAGAATAGAATAGGG + Intronic
1066466869 10:35659485-35659507 GGTTTCATGAAACCAGAAAATGG - Intergenic
1067811448 10:49430102-49430124 GGTGGATGGAGAATAGAAAAAGG + Intergenic
1068296972 10:55083562-55083584 AGTGTAATCAGACAAGAGAAAGG + Intronic
1070998287 10:80806164-80806186 GGTTTATTGAGACTAGAGAATGG - Intergenic
1072183517 10:93011702-93011724 GATGTAATGATACTAGAGAAAGG + Intronic
1072183521 10:93011756-93011778 GACGTAATGATACTAGAGAAAGG + Intronic
1072410532 10:95197916-95197938 GGTTTATTGAGACTAGAGAATGG + Intronic
1072541750 10:96403551-96403573 GGTTTATTGAGACTAGAGAATGG - Intronic
1072708548 10:97700101-97700123 GGTTTATTGAGACTAGAGAATGG - Intergenic
1072883061 10:99247806-99247828 AGTGTCATGAGAACAGAAAAGGG - Intergenic
1073106324 10:101034255-101034277 GGTTTATTGAGACTAGAGAATGG + Intronic
1074336153 10:112577921-112577943 GAAGAAATGAGAATAGAAAATGG - Intronic
1074337165 10:112589755-112589777 GAAGTAATGCTACTAGAAAATGG + Intronic
1077344981 11:2043072-2043094 GGTGTATGGAGAATGGAAAAAGG - Intergenic
1077345187 11:2044795-2044817 GGAGTATAGAGAATAGAAAATGG - Intergenic
1077577456 11:3395275-3395297 GGTTTATTGAGACTAGAGAATGG + Intergenic
1077585455 11:3448146-3448168 GGTTTATTGTGACTAGAGAATGG + Intergenic
1077586363 11:3456673-3456695 GGTTTATTGTGACTAGAGAATGG + Intergenic
1077597356 11:3545635-3545657 GGTTTATTGAGACTAGAGAATGG - Intergenic
1078504519 11:11923997-11924019 AGTGCAGTGAGACAAGAAAAAGG - Intronic
1079154370 11:17930771-17930793 GGTGAAATGAGACCTGAATAAGG - Intronic
1079444355 11:20545919-20545941 GGAGCAAGGAGACGAGAAAAAGG - Intergenic
1079664944 11:23093226-23093248 GGTTTATTGAGACTAGAGAATGG + Intergenic
1079851429 11:25540985-25541007 GGTTTATTGAGACTAGAGAATGG - Intergenic
1081019739 11:37930850-37930872 GGTTTATTGAGACTAGAGAATGG - Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1082724482 11:56718938-56718960 GGTTTATCGAGACTAGAGAATGG - Intergenic
1083797201 11:65023919-65023941 GGTTTATTGAGACTAGAGAATGG + Intronic
1084226406 11:67717210-67717232 GGTTTATTGAGACTAGAGAATGG + Intergenic
1084229407 11:67740060-67740082 GGTTTATTGAGACTAGAGAATGG + Intergenic
1084242365 11:67830705-67830727 GGTTTATTGTGACTAGAGAATGG + Intergenic
1084253459 11:67921543-67921565 GGTTTATTGAGACTAGAGAATGG - Intergenic
1084259852 11:67968971-67968993 GGTTTATTGAGACTAGAGAATGG + Intergenic
1084808785 11:71599645-71599667 GGTTTATTGAGACTAGAGAATGG - Intronic
1084812923 11:71626281-71626303 GGTTTATTGAGACTAGAGAATGG - Intergenic
1084819419 11:71674383-71674405 GGTTTATTGAGACTAGAGAATGG + Intergenic
1084845892 11:71899637-71899659 GGTTTATTGAGAATAGAGAATGG - Intronic
1085268506 11:75253338-75253360 AGTGCAATAAGACAAGAAAAAGG - Intergenic
1085463881 11:76711370-76711392 GGTTTATTGAGACTAGAGAATGG - Intergenic
1086074059 11:82831313-82831335 GCTGTAATGAGACTATTAACAGG + Intronic
1088081916 11:105927716-105927738 GATTTAAAAAGACTAGAAAAAGG - Intronic
1088858360 11:113777321-113777343 GGTTTATTGAGACTAGAGAATGG - Intergenic
1089368608 11:117936998-117937020 GTTGTAAAGAGAATAGATAAAGG - Intergenic
1089512499 11:119008825-119008847 GGTTTATTGAGACTAGAGAATGG + Intronic
1090039704 11:123279965-123279987 GGTTTATTGAGACTAGAGAATGG - Intergenic
1090718082 11:129447795-129447817 GTAGTAATCAAACTAGAAAAGGG - Intronic
1202827911 11_KI270721v1_random:97945-97967 GGTGTATGGAGAATGGAAAAAGG - Intergenic
1091693771 12:2614320-2614342 GGTGTAAAGAGAAAGGAAAATGG + Intronic
1091859388 12:3766029-3766051 TGTGTAATGGGACTATCAAAAGG + Intergenic
1092405651 12:8220461-8220483 GGTTTATTGAGACTAGAGAATGG - Intergenic
1092431150 12:8409941-8409963 GGTTTATTGAGACTAGAGAATGG + Intergenic
1092434055 12:8432133-8432155 GGTTTATTGAGACTAGAGAATGG + Intergenic
1094118584 12:26944269-26944291 GGTGTAATAAGGCTAGGAAGGGG - Intronic
1094815668 12:34180996-34181018 GGTTTATTGAGACTAGAGAATGG + Intergenic
1095456108 12:42387971-42387993 GGTTTATCGAGACTAGAGAATGG - Intronic
1095536770 12:43258097-43258119 GGAATAATGAGACTATACAAGGG + Intergenic
1096125416 12:49115928-49115950 GGTTTATTGAGACTAGAGAATGG - Intergenic
1096826993 12:54287213-54287235 GGTTTAATGAAAATAGAAATGGG + Intergenic
1097343396 12:58465259-58465281 GGCATAATTAGCCTAGAAAAAGG + Intergenic
1099851211 12:88099634-88099656 AGGGTAATGAGACTAAAAAGAGG + Intronic
1100987208 12:100213677-100213699 GGTATGATTAGATTAGAAAAGGG + Intronic
1101798271 12:107997759-107997781 GGTTTGTTGAGACTAGAGAATGG + Intergenic
1104238118 12:126959395-126959417 GGTTTATTGAGACTGGAGAATGG + Intergenic
1105055101 12:133091254-133091276 GGTTTATTGAGACTAGAGAATGG + Intronic
1105055643 12:133096189-133096211 GGTTTATTGAGACTAGAGAATGG + Intronic
1107667816 13:42711058-42711080 GGGTTATTGAGACTAGAGAATGG - Intergenic
1107741689 13:43456836-43456858 GGAGTCATGAGACTGGAAAAAGG - Intronic
1110154539 13:72298956-72298978 ATTGTAATGAGAATAGAAAATGG + Intergenic
1110260182 13:73475901-73475923 GGTGTATTTATACCAGAAAAGGG - Intergenic
1113970194 13:114182632-114182654 GGTTTATTGAGACTAGAGGATGG + Intergenic
1113991690 14:16032786-16032808 CGTTTATTGAGACTAGAGAATGG - Intergenic
1114006527 14:18319732-18319754 GGTTTATCGAGACTAGAGAATGG - Intergenic
1114072926 14:19129695-19129717 GGTTTATCGAGACTAGAGAATGG - Intergenic
1114089339 14:19270298-19270320 GGTTTATCGAGACTAGAGAATGG + Intergenic
1114168069 14:20242279-20242301 GGTTTATTGAGACTAGAGAATGG + Intergenic
1114607634 14:24010414-24010436 GGTTTATTGAGACTAGAGAATGG + Intergenic
1114973345 14:28062119-28062141 GGTGGCATCAGACTATAAAAAGG + Intergenic
1116825076 14:49665308-49665330 GGGGTTATCAGACTAGTAAATGG - Intronic
1117335439 14:54753316-54753338 GGTTTATTGAGACTAGAGAATGG + Intronic
1117783865 14:59262171-59262193 AGTGGAATAAGATTAGAAAAAGG - Intronic
1118711487 14:68523190-68523212 GCTGTGATGAGAGTAGAAAGCGG + Intronic
1120264383 14:82231076-82231098 GGTGTGAACAGACTATAAAAAGG + Intergenic
1120990341 14:90370687-90370709 GATTAAATGAGACTAGAGAAAGG + Intergenic
1121377700 14:93429914-93429936 GGTGTAGGGAGATTAGAAGATGG + Intronic
1121527042 14:94626404-94626426 GGTTTATTGAGACTAGAGAATGG - Intergenic
1123390459 15:19866371-19866393 GGTTTATTGAGAATAGAGAATGG - Intergenic
1126002912 15:44228865-44228887 GGTTTATTGAGACTAGAGAATGG - Intergenic
1126391189 15:48154790-48154812 GGAGTGATGACACAAGAAAATGG + Intronic
1126449369 15:48789107-48789129 GTTTTAATGAGAGTAGAGAAGGG + Intronic
1127447457 15:59079561-59079583 TCTGTAATGAAACTAGAGAATGG + Intronic
1128373323 15:67057188-67057210 GGTGTGATGAGAGCAGAACAAGG - Intergenic
1131194839 15:90347284-90347306 GGCTTATTGAGACTAGAGAATGG + Intergenic
1131946703 15:97629825-97629847 GGTTTACTGAGACTAGAGAATGG + Intergenic
1132831628 16:1931112-1931134 GGTTTATTGAGACTGGAGAATGG - Intergenic
1134007874 16:10830179-10830201 GGTTTATTGAGACTAGAGAATGG + Intergenic
1135044655 16:19145304-19145326 GGTGGAGTGGGACTAGAAAAAGG + Intronic
1136991449 16:35153718-35153740 GGTTTATTGAGACTAGAGAATGG - Intergenic
1139121160 16:64019309-64019331 GGTTTAAGGAAACCAGAAAATGG + Intergenic
1139394370 16:66628450-66628472 GGTTTATTGAGACTAGAGAATGG + Intronic
1139439170 16:66956101-66956123 GGTTTATTGAGACTAGAGAATGG + Intergenic
1139565820 16:67775434-67775456 GATGCAATCAGACAAGAAAAAGG + Intronic
1140081949 16:71756561-71756583 GGTGTAATAAAAGTAGAATATGG - Intronic
1140246340 16:73253294-73253316 GGTGTAATGAAAGGAGAACAGGG + Intergenic
1140815767 16:78619378-78619400 AGTGTAATGCAAGTAGAAAAGGG + Intronic
1144369441 17:14576004-14576026 GGTGGAGGGAGACTTGAAAATGG - Intergenic
1144571198 17:16400386-16400408 GGTTTATTGAGACTAGAGAATGG - Intergenic
1145363297 17:22229922-22229944 GGTTTATTGAGACTAGAGAATGG - Intergenic
1146222772 17:31039640-31039662 GATTTGATGAGACTACAAAAGGG - Intergenic
1146319866 17:31838771-31838793 GATGTAATAGGACTGGAAAAGGG - Intergenic
1146342226 17:32030370-32030392 GATTTGATGAGACTACAAAAGGG + Intronic
1146350582 17:32089226-32089248 GATTTGATGAGACTACAAAAGGG - Intergenic
1147576036 17:41599579-41599601 GGTGGAATGAGACTGTAAGAGGG - Intergenic
1149326352 17:55534355-55534377 GGTGTTATGTGACTAAAACATGG + Intergenic
1150783777 17:68145846-68145868 GATTTGATGAGACTACAAAAGGG - Intergenic
1154025375 18:10702805-10702827 AGTGCAATGTGACAAGAAAAGGG + Intronic
1154530942 18:15344466-15344488 GGTTTATCGAGACTAGAGAATGG + Intergenic
1156947721 18:42855498-42855520 CCTGTAATGAGAACAGAAAATGG + Intronic
1157297263 18:46455349-46455371 GGTGTGAAGGGACCAGAAAAGGG + Intronic
1158380066 18:56919845-56919867 GGTGTCATGTGATTAGAAAAGGG - Intronic
1158401274 18:57123376-57123398 GGCATAAAGAGACTACAAAATGG - Intergenic
1158809580 18:61016660-61016682 AGTATAATGAAACAAGAAAAAGG - Intergenic
1159476389 18:68925470-68925492 GGTGACATCAGATTAGAAAAAGG + Intronic
1159606431 18:70479405-70479427 GGTTTATTGAGACTAGAGAATGG - Intergenic
1160270378 18:77378283-77378305 TGTGCAGTGAGACTAGCAAAGGG - Intergenic
1160419454 18:78734185-78734207 GCTGAAATCAGACTGGAAAATGG - Intergenic
1166172214 19:41036767-41036789 GGTTTATTGAGACTAGAGAATGG + Intergenic
1166248010 19:41544862-41544884 GGTTTATTGAGACTAGAGAATGG - Intergenic
1168235408 19:55059956-55059978 GGTTTATTGAGACTAGAGACTGG - Intronic
924967826 2:94316-94338 GGTTTATTGAGACTAGAGAATGG - Intergenic
925037678 2:703272-703294 GGCTTATTGAGACTAGAGAATGG + Intergenic
926617247 2:15009180-15009202 TGTGGACTGAGACAAGAAAAAGG + Intergenic
927188843 2:20501892-20501914 GGTTTATTGAGACTAGAGAATGG + Intergenic
932600353 2:73119901-73119923 GGTTTATCGAGACTAGAGAATGG + Intronic
933538982 2:83615156-83615178 GGTCTTCTGAGACTAGAAGAAGG - Intergenic
933886614 2:86723785-86723807 AGGGTGCTGAGACTAGAAAAGGG - Intronic
933923566 2:87072920-87072942 AGGGTGCTGAGACTAGAAAAGGG + Intergenic
934542952 2:95191624-95191646 GGTTTATTGAGACTAGAGAATGG - Intergenic
934592368 2:95567449-95567471 GGTTTATTGAGACTAGAGAATGG - Intergenic
935315072 2:101824873-101824895 GGTCTAATGTGAATAAAAAATGG - Intronic
935460421 2:103325565-103325587 GGTGTAAGAAGACTAAGAAAAGG + Intergenic
935656138 2:105425311-105425333 GGTTTATTGAGACTAGAGAATGG - Intronic
935863535 2:107360394-107360416 TTAGTAATGAGAGTAGAAAATGG - Intergenic
936107512 2:109637559-109637581 GGTTTATTGAGACTAGAGAATGG + Intergenic
938235348 2:129701634-129701656 GGTTTATTGAGACTAGAGAATGG - Intergenic
938530033 2:132175740-132175762 GGTTTATCGAGACTAGAGAATGG + Intronic
940358360 2:152769800-152769822 GGTTTATCGAGACTAGAGAATGG + Intergenic
940847375 2:158656539-158656561 GGTGGAATAGGAGTAGAAAAGGG + Intronic
941294052 2:163714083-163714105 CGTGTAATCAGATTGGAAAATGG - Intronic
941720255 2:168805109-168805131 GGTTTCATGAGACTACAAAAAGG + Intronic
942256259 2:174102053-174102075 GGAATAATGAAACTTGAAAAGGG + Intronic
942535853 2:176962708-176962730 GATGAAATGAGGGTAGAAAAAGG + Intergenic
942996230 2:182263770-182263792 GTTGTAAGGAGATTAGGAAAGGG - Intronic
943104075 2:183521350-183521372 GTTGAAATGAGTCTATAAAAAGG - Intergenic
943247882 2:185478426-185478448 GGTGTAAAGTAAATAGAAAATGG + Intergenic
944193223 2:197025682-197025704 GCTGTAATGAGAATAAAATACGG + Intronic
945136785 2:206637876-206637898 GGTGTAAGCAGGCTAGAAAAAGG - Intergenic
945685756 2:212967713-212967735 GTTGTAAGGAGACTTGTAAATGG + Intergenic
946167386 2:217873294-217873316 GGTGTAAAAAGATTAGAAAGTGG + Intronic
946979160 2:225188043-225188065 GGTGTCATTCCACTAGAAAATGG - Intergenic
948843435 2:240671629-240671651 GGTTTATTGAGACTGGAGAATGG - Intergenic
948851092 2:240706351-240706373 GTTGTATTGAAACCAGAAAAAGG + Intergenic
1169876741 20:10306118-10306140 GTTGGAATCAGCCTAGAAAAGGG - Exonic
1170397885 20:15947387-15947409 GGTTTATTGAGACTGGAGAATGG + Intronic
1171770175 20:29316876-29316898 CGTTTATTGAGACTAGAGAATGG + Intergenic
1171812884 20:29759671-29759693 CGTTTATTGAGACTAGAGAATGG + Intergenic
1172578132 20:36025138-36025160 GATATAATGATACTGGAAAAGGG + Intronic
1173276332 20:41586967-41586989 AGTGCAATAAGACAAGAAAAAGG + Intronic
1173727542 20:45307965-45307987 GGAGGGATGAGAGTAGAAAAGGG + Intronic
1175454138 20:59097159-59097181 TGTTAAATGAGAATAGAAAAAGG - Intergenic
1175537879 20:59727927-59727949 CGTGGAATGAGACATGAAAAGGG + Intronic
1176127350 20:63481961-63481983 GGTTTACAGAGACTAGGAAATGG + Intergenic
1176766469 21:13023996-13024018 GGTTTATCGAGACTAGAGAATGG - Intergenic
1178799787 21:35782152-35782174 GTTGTAATGACACTAGCAAGTGG - Intronic
1179123734 21:38573138-38573160 GGTTTATTGAGGCTAGAGAATGG - Intronic
1180315580 22:11274741-11274763 CGTTTATTGAGACTAGAGAATGG + Intergenic
1180431036 22:15250543-15250565 GGTTTATCGAGACTAGAGAATGG - Intergenic
1180491368 22:15852049-15852071 GGTTTATCGAGACTAGAGAATGG - Intergenic
1180513599 22:16118444-16118466 GGTTTATTGAGACTAGAGAATGG - Intergenic
1180606003 22:17059417-17059439 GTTTTATTGAGACTAGAGAATGG - Intergenic
1181472416 22:23149023-23149045 GGTGAAAGGAGACTGGCAAAGGG - Intronic
1181733851 22:24866918-24866940 GGGGTTCTGAGACCAGAAAAAGG + Intronic
1181923168 22:26336396-26336418 GGGGAAATGAGACAAGAAGAAGG - Intronic
1182918679 22:34059592-34059614 GGTGAAATGAGGCAAGAGAAAGG + Intergenic
949804658 3:7941958-7941980 GGTTTATTGAGACTAGAGAATGG - Intergenic
950753078 3:15146244-15146266 GGTTTATTGAGACTAGAGAATGG + Intergenic
951015821 3:17731528-17731550 GGTGTCATGAGACTGGAAATAGG + Intronic
951886668 3:27531525-27531547 GGTTTATCGAGACTAGAGAATGG - Intergenic
952685390 3:36141794-36141816 GGTTTATTGAGACTAGAGAATGG + Intergenic
953618094 3:44510191-44510213 AGTGAAATAAGACAAGAAAAAGG + Intronic
954358890 3:50107233-50107255 TGTGCAATGATACTAAAAAAAGG - Intronic
955471288 3:59288992-59289014 GGTGTAAACAGATCAGAAAAGGG - Intergenic
955675479 3:61443657-61443679 AGTGGAATGTGATTAGAAAAGGG - Intergenic
957045985 3:75374887-75374909 GGTTTATTGAGACTGGAGAATGG + Intergenic
957067526 3:75538004-75538026 GGTTTATTGAGACTAGAGAATGG - Intergenic
957069868 3:75559253-75559275 GGTTTATTGAGACTAGAGAATGG - Intergenic
957074804 3:75593394-75593416 GGTTTATTGAGACTAGAGAAGGG + Intergenic
957789660 3:84923264-84923286 AGTGCAATTAGACAAGAAAAAGG + Intergenic
958765599 3:98363279-98363301 GGTTTATTGAGACTAGAGAATGG + Intergenic
958904815 3:99930194-99930216 TGTGTAATTAGACTACAAGAAGG - Intronic
959251600 3:103955073-103955095 AGTGAAATGACACAAGAAAACGG - Intergenic
960809150 3:121611810-121611832 GGTTTATTGAGACTAGAGAATGG + Intronic
961276401 3:125730723-125730745 GGTTTATTGAGACTAGAGAATGG - Intergenic
961279303 3:125753316-125753338 GGTTTATTGAGACTAGAGAATGG - Intergenic
961285623 3:125799969-125799991 GGTTTATTGAGACTAGAGATTGG + Intergenic
961517575 3:127447605-127447627 GGAGTAATGAGATTTGAAGACGG + Intergenic
961875097 3:130016295-130016317 GGTTTATTGAGACTAGACAATGG + Intergenic
961878036 3:130039010-130039032 GGTTTATTGAGACTAGAGAATGG + Intergenic
961890164 3:130124059-130124081 GGTTTATTGAGACTAGAGAATGG + Intergenic
963216343 3:142752768-142752790 GGTTTATTGAGACTAGAGAATGG + Intronic
965257556 3:166434668-166434690 AGTGTAAGGAGAGTATAAAAAGG - Intergenic
966293035 3:178383002-178383024 TGTGTAACAAGATTAGAAAAAGG - Intergenic
966733544 3:183170262-183170284 GGTTTATTGAGACTAGAGAATGG - Intergenic
966771934 3:183511645-183511667 GGTTTATTGAGACTGGAGAATGG + Intronic
967417199 3:189232504-189232526 GGTGTAACGAGGCTTGACAATGG - Intronic
968061419 3:195728821-195728843 GGTTTATTGAGACTAGAGAATGG + Intronic
968373694 4:19286-19308 GGTTTATTGAGACTAGAGAATGG - Intergenic
968987450 4:3884072-3884094 GGTTTATTGACACTAGAGAATGG + Intergenic
968990251 4:3906043-3906065 GGGTTATTGAGACTAGAGAATGG + Intergenic
969000637 4:3978047-3978069 GGTTTGTTGAGACTAGAGAATGG + Intergenic
969001560 4:3986624-3986646 GGTTTGTTGAGACTAGAGAATGG + Intergenic
969012106 4:4074574-4074596 GGTTTATTGAGACAAGAGAATGG - Intergenic
969018406 4:4121032-4121054 GGTTTATTGAGACTAGAGAATGG + Intergenic
969023094 4:4151233-4151255 GGTTTATTGAGACTAGAAAATGG + Intergenic
969730713 4:8955850-8955872 GGTTTATTGAGACTAGAGAATGG - Intergenic
969735579 4:8987686-8987708 GGTTTATTGAGACTAGAGAATGG - Intergenic
969741982 4:9035135-9035157 GGTTTATTGAGACAAGAGAATGG + Intergenic
969752458 4:9122067-9122089 GGTTTATTGAGACTAGAGAATGG - Intergenic
969753378 4:9130626-9130648 GGTTTATTGTGACTAGAGAATGG - Intergenic
969760464 4:9177522-9177544 GGTTTATTGAGACTAGAGAATGG + Intergenic
969786884 4:9465479-9465501 GGTTTATTGAGACTAGAGAATGG - Intergenic
969790312 4:9489958-9489980 GGTTTATTGAGACTAGAGAATGG - Intergenic
969794797 4:9519141-9519163 GGTTTATTGAGACTAGAGAATGG - Intergenic
969801354 4:9568035-9568057 GGTTTATTGAGACTAGAGAATGG + Intergenic
969812357 4:9658236-9658258 GGTTTGTTGAGACTAGAGAATGG - Intergenic
969813281 4:9666809-9666831 GGTTTGTTGAGACTAGAGAATGG - Intergenic
969825072 4:9751323-9751345 GGTTTATTGAGACTAGAGAATGG - Intergenic
970273493 4:14371757-14371779 GATGTTATGAGAGTAGATAATGG + Intergenic
970467448 4:16340259-16340281 TGTGTAATATGACTTGAAAAGGG + Intergenic
971720090 4:30233607-30233629 GGTTTATTGAGACTAGAGAATGG + Intergenic
972401785 4:38711330-38711352 GGTATAGTGAGACAAGCAAATGG + Intergenic
972846958 4:43002355-43002377 GGTTTATTGAGACTAGAGAATGG + Intronic
972997912 4:44905367-44905389 GATGGAATGAAACTAGAAAATGG - Intergenic
973101350 4:46275150-46275172 GGTTTAATGAGACCAGAAATAGG - Intronic
973343549 4:49030370-49030392 CCTGTAATCAGACTAAAAAAGGG - Intronic
974945870 4:68528523-68528545 GGTTTATTGAGACTAGAGAATGG - Intergenic
974952340 4:68598283-68598305 GGTTTATTGAGACTAGAGAATGG - Intronic
977338739 4:95730306-95730328 GGGGTCATGAGTTTAGAAAAAGG + Intergenic
977911082 4:102537418-102537440 GCTGTAATCAGAGTAGATAAAGG + Intronic
978048897 4:104171251-104171273 GGTTTATTGAGACTAGAGAATGG - Intergenic
978318669 4:107468720-107468742 TGTGTAATGTGTCTAGATAAAGG - Intergenic
978538321 4:109786870-109786892 GGTGAAATGAGGATAGAACAAGG - Intronic
978751351 4:112251373-112251395 TGTATAATTAGACTAGAACATGG + Intronic
979497179 4:121396809-121396831 GGTTTATTGAGACTAGAGAATGG - Intergenic
979501629 4:121446741-121446763 GGTTTATTGAGACTAGAGAATGG + Intergenic
979996741 4:127440194-127440216 GGTTTATTGAGACTAGAGAATGG + Intergenic
980515046 4:133845921-133845943 TGTATAATGAGAATAGCAAAAGG - Intergenic
982356406 4:154474168-154474190 GGTGTCATGAGACAAGGGAAAGG - Intronic
982518817 4:156387076-156387098 GGTTTATTGAGACTAGAGAATGG + Intergenic
982618165 4:157668144-157668166 GGTGTTATGTCACTACAAAAAGG + Intergenic
983212732 4:164975640-164975662 GGTTTATTGAGACTAGAGAATGG - Intronic
983313294 4:166093786-166093808 GGTTTATCGAGACTAGAGAATGG + Intronic
984011036 4:174372145-174372167 GGTGTATTGGGACCATAAAATGG - Intergenic
984802393 4:183726982-183727004 GGTTTATTGAGACTAGAGAATGG + Intergenic
985351413 4:189066806-189066828 GATAAAAAGAGACTAGAAAATGG - Intergenic
985461043 4:190106981-190107003 GGTTTATTGAGACTAGAGAATGG + Intergenic
985461693 4:190113265-190113287 GGTTTATTGAGACTAGAGAATGG + Intergenic
986227138 5:5826435-5826457 GGAGGAATGAGACCAGAAAAGGG + Intergenic
986277572 5:6291733-6291755 GGTGCAATAAAAATAGAAAAAGG + Intergenic
987630775 5:20469029-20469051 GTTGCAAAGAGGCTAGAAAATGG - Intronic
987936024 5:24466022-24466044 GGTTTATTGAAACTAGAGAATGG - Intergenic
987985739 5:25143258-25143280 GTTGTAATTAGACTAAGAAATGG - Intergenic
988033974 5:25801762-25801784 AGTAAAATGAGATTAGAAAAAGG - Intergenic
988062970 5:26197688-26197710 GGTTTATTGAGACTAGAGAGTGG - Intergenic
988161024 5:27518398-27518420 GGTGTTCTGAGTCTAGAAACTGG + Intergenic
989089318 5:37713285-37713307 GGTTAAATGATACTAGGAAATGG - Intronic
989296149 5:39828764-39828786 GGTTTATTGAGACTAGAGAATGG + Intergenic
990619724 5:57546922-57546944 GGTTTATTGAGACTAGAGAATGG - Intergenic
994404569 5:99328677-99328699 GGTTTATTGAGACTAGAGAATGG - Intergenic
994503184 5:100606307-100606329 GGTTTACTGAGACTAGAGAATGG - Intergenic
994794257 5:104274679-104274701 ATTGTAATGAGAACAGAAAATGG + Intergenic
995320785 5:110831344-110831366 GGGGCAATGAGACTAAAAAATGG - Intergenic
995567625 5:113447990-113448012 GGTGTAGAGGGACTGGAAAAAGG + Intronic
995673640 5:114636591-114636613 ACTGTAATGAGAATAGCAAAGGG + Intergenic
996190473 5:120534629-120534651 TGTGTAAGGAGAGAAGAAAAAGG - Intronic
996395904 5:123013692-123013714 AGTGTAATGAAAACAGAAAATGG - Intronic
998607331 5:143648511-143648533 GGTGTCCTGAGACAAGAAGATGG - Intergenic
999516337 5:152305611-152305633 GATGTAATGTGATTATAAAAGGG - Intergenic
999560683 5:152798009-152798031 GGTTTATTGAGACTAGAAAATGG + Intergenic
999752211 5:154636677-154636699 GGTTTATTGAGACTAGAGAATGG + Intergenic
999753060 5:154644371-154644393 GGTTTATTGAGACTAGAGAATGG + Intergenic
1000420218 5:161030135-161030157 GATGTGATAAGACTATAAAATGG + Intergenic
1000526992 5:162370386-162370408 GGTTTATTGAGACTAGAGAATGG - Intergenic
1002035429 5:176465200-176465222 GGTCAAATAAGACTAGAAAATGG - Intronic
1002268935 5:178056741-178056763 GGTTTATTGAGACTGGAGAATGG + Intergenic
1002650607 5:180690267-180690289 GGTTTATTGAGACTAGAGAATGG + Intergenic
1002970780 6:2016651-2016673 CATGTAATAAGACTATAAAATGG + Intronic
1003250421 6:4424839-4424861 AATGTAATAAGACAAGAAAAGGG + Intergenic
1005123619 6:22419923-22419945 TGTGTAATGAGAAAAGAAAAGGG - Intergenic
1005430280 6:25749206-25749228 GGTTTATTGAGAATAGAGAATGG + Intergenic
1005618429 6:27597445-27597467 GGTTTATCGAGACTAGAGAATGG + Intergenic
1006897563 6:37480688-37480710 GGGGGAAGGAGACAAGAAAATGG - Exonic
1007624932 6:43240218-43240240 GGTTTATTGAGACTAGAGAATGG + Intergenic
1008008300 6:46436124-46436146 AGGGTAGTGAGACTAGACAATGG + Intronic
1008232081 6:48995248-48995270 GGGGAAATGAGATTAGAAATTGG - Intergenic
1008563927 6:52748999-52749021 GGTTTATTGAGACTAGAGAATGG + Intergenic
1008565783 6:52766629-52766651 TGTGGAATGAGAAGAGAAAATGG - Intergenic
1008569969 6:52806965-52806987 TGTGGAATGAGAGGAGAAAATGG - Intergenic
1008578429 6:52883518-52883540 GGTTTATTGAGACTAGAGAATGG - Intronic
1008580011 6:52898160-52898182 TGTGGAATGAGAAGAGAAAATGG - Intronic
1008585890 6:52948421-52948443 GGTTTATTGAGACTAGAGAATGG + Intergenic
1008774529 6:55021107-55021129 GTTGCAATAAGACAAGAAAAAGG - Intergenic
1008811301 6:55503532-55503554 TGTGTAATGAGAATGAAAAAGGG + Intronic
1008928785 6:56915441-56915463 GGTGTGGTGAGAAAAGAAAATGG + Intronic
1009193284 6:60655267-60655289 GGTTTATTGAGACTAGAGAATGG - Intergenic
1009193698 6:60660238-60660260 GGTTTATTGAGACTAGAGAATGG - Intergenic
1010423884 6:75704801-75704823 GGTTTATCGAGACTAGAGAATGG + Intronic
1010709739 6:79159987-79160009 GGGGTGAAGAGACTATAAAAAGG - Intergenic
1010839709 6:80634937-80634959 GGTTTATTCAGACTAGAGAATGG - Intergenic
1012120623 6:95361923-95361945 GGTTTATTGAGACTAGAGAATGG + Intergenic
1014875915 6:126659070-126659092 GGTGTCATATGACTAAAAAAAGG + Intergenic
1015555784 6:134459925-134459947 GGTGTTCTGAGACTAGCAAAGGG - Intergenic
1015567825 6:134591703-134591725 GGTGTATGGAGAGGAGAAAAGGG + Intergenic
1016177351 6:141096932-141096954 GGTTTATTAAGACTAGAGAATGG + Intergenic
1016292624 6:142540904-142540926 GGTGTAAGGAGGAGAGAAAAAGG - Intergenic
1016472605 6:144390286-144390308 GAAGTAATGAGACAAGAAAGGGG - Intronic
1016685773 6:146880607-146880629 GGTGTAATGGGGCTGGATAAGGG - Intergenic
1016812924 6:148278375-148278397 GCTGTAATGAGAAAAAAAAATGG - Intronic
1017945061 6:159089813-159089835 AGTGTAATGAGAAATGAAAAGGG - Intergenic
1018060133 6:160083635-160083657 GGTTTATTGAGACTAGAGAATGG + Intronic
1018324697 6:162653192-162653214 AGTTTAATGAGACTGGAAAGAGG + Intronic
1018876053 6:167824085-167824107 GGTGCAATGAGAATAGAAGATGG + Intergenic
1020310145 7:6860957-6860979 GGTTTATTGAGACTAGAGAATGG + Intergenic
1020313084 7:6884097-6884119 GGTTTATTGAGACTAAAGAATGG + Intergenic
1021482736 7:21135789-21135811 GATGTAATCATTCTAGAAAAAGG - Intergenic
1022779636 7:33566990-33567012 GGGGTAATGAGACCAATAAAAGG + Intronic
1023248373 7:38231565-38231587 GGTTTATTGAGACTAGAGAATGG + Intergenic
1023893466 7:44411917-44411939 TGTGGAATGAGGCTAGAAAGAGG - Intronic
1024446987 7:49492227-49492249 ATAGTAATGAGACTAGAAATTGG + Intergenic
1024474708 7:49798343-49798365 GGTGAAATGAGCCTAAAAGAGGG + Intronic
1025075992 7:55943599-55943621 GGTTTATTGAGACTAGAGAATGG + Intergenic
1025574518 7:62619482-62619504 GGTTTACTGAGACTAGATAATGG - Intergenic
1025871208 7:65435891-65435913 TGTGTAGCGAGACTAGAAACAGG - Intergenic
1026188683 7:68104474-68104496 GGTTTATTGAGACTAGAGAATGG + Intergenic
1026736383 7:72951464-72951486 GGTTTATTGAGACTAGAGAACGG - Intergenic
1027107350 7:75413598-75413620 GGTTTATTGAGACTAGAGAACGG + Intergenic
1027740082 7:81990512-81990534 GGTGTCATGAGATTAAAAGATGG + Intronic
1029076893 7:97941740-97941762 GGTTTATTGAGAATAGAGAATGG + Intergenic
1029501054 7:100930076-100930098 GGTACAATGAGACAAGAAAGAGG - Intergenic
1030009140 7:105148920-105148942 GGTTTATTGAGACTAGAGAATGG - Intronic
1030613234 7:111711336-111711358 CTTGTAATGAGACAAGACAATGG - Intergenic
1030834294 7:114264158-114264180 GGTATAATCATACTAGAATAAGG - Intronic
1030903958 7:115159845-115159867 GGAGTATTCAGCCTAGAAAAAGG - Intergenic
1031756632 7:125652019-125652041 GGTGTGATGAGAACAGAGAATGG - Intergenic
1032546204 7:132745305-132745327 GGAAAAATGATACTAGAAAAAGG + Intergenic
1032761937 7:134951580-134951602 GGTGAAATGTGACTTGGAAAGGG + Intronic
1033715442 7:143996837-143996859 GGTTTATCGAGACTAGAGAATGG + Intergenic
1034231770 7:149535141-149535163 GGGGAAATGAGAGCAGAAAAAGG + Intergenic
1035482187 7:159196290-159196312 GCTTTAAAGAGACCAGAAAATGG + Intergenic
1035517999 8:253038-253060 GGTTTATTGAGACTAGAGCATGG - Intergenic
1035657269 8:1319613-1319635 GCTGTGATGAGATGAGAAAAGGG + Intergenic
1036240884 8:7080214-7080236 GGTTTAATGAGACGAGAGAATGG - Intergenic
1036247174 8:7127702-7127724 GGTTTATTCAGACTAGAGAATGG + Intergenic
1036253622 8:7186660-7186682 GGTTTATTGAGACGAGAGAATGG - Intergenic
1036261172 8:7241377-7241399 GGTTTATTGATACTAGAGAATGG + Intergenic
1036262797 8:7253632-7253654 GGTTTATTGAAACTAGAGAATGG + Intergenic
1036264105 8:7261264-7261286 GGTTTATTGAGACTAGGGAATGG + Intergenic
1036265400 8:7268886-7268908 GGTTTATTGAGACTAGGGAATGG + Intergenic
1036266702 8:7276508-7276530 GGTTTATTGAGACTAGGGAATGG + Intergenic
1036268008 8:7284130-7284152 GGTTTATTGAGACTAGGGAATGG + Intergenic
1036269312 8:7291752-7291774 GGTTTATTGAGACTAGGGAATGG + Intergenic
1036270577 8:7299362-7299384 GGTTTATTGAGACTAGAGAATGG + Intergenic
1036297283 8:7547672-7547694 GGTTTATTGAGACTAGAGAATGG - Intergenic
1036298584 8:7555327-7555349 GGTTTATTGAGACTAGGGAATGG - Intergenic
1036299889 8:7562977-7562999 GGTTTATTGAGACTAGGGAATGG - Intergenic
1036301196 8:7570623-7570645 GGTTTATTGAGACTAGAGAATGG - Intergenic
1036302496 8:7578272-7578294 GGTTTATTGAGACTAGAGAATGG - Intergenic
1036303792 8:7585926-7585948 GGTTTATTGAAACTAGAGAATGG - Intergenic
1036305431 8:7598170-7598192 GGTTTATTGATACTAGAGAATGG - Intergenic
1036313211 8:7699921-7699943 GGTTTATTGATACTAGAGAATGG + Intergenic
1036314837 8:7712171-7712193 GGTTTATTGAAACTAGAGAATGG + Intergenic
1036316145 8:7719803-7719825 GGTTTATTGAGACTAGGGAATGG + Intergenic
1036317454 8:7727451-7727473 GGTTTATTGAGACTAGGGAATGG + Intergenic
1036318762 8:7735099-7735121 GGTTTATTGAGACTAGGGAATGG + Intergenic
1036320069 8:7742746-7742768 GGTTTATTGAGACTAGGGAATGG + Intergenic
1036321378 8:7750394-7750416 GGTTTATTGAGACTAGGGAATGG + Intergenic
1036322687 8:7758042-7758064 GGTTTATTGAGACTAGGGAATGG + Intergenic
1036323990 8:7765691-7765713 GGTTTATTGAGACTAGAGAATGG + Intergenic
1036325295 8:7773347-7773369 GGTTTATTGAGACTAGAGAATGG + Intergenic
1036350772 8:8010982-8011004 GGTTTATTGAGACTAGAGAATGG - Intergenic
1036352050 8:8018616-8018638 GGTTTATTGAGACTAGAGAATGG - Intergenic
1036353350 8:8026262-8026284 GGTTTATTGAGACTGGAGAATGG - Intergenic
1036354647 8:8033918-8033940 GGTTTATTGAAACTAGAGAATGG - Intergenic
1036356281 8:8046167-8046189 GGTTTATTGATACTAGAGAATGG - Intergenic
1036363870 8:8100820-8100842 GGTTTATTGAGACGAGAGAATGG + Intergenic
1036375670 8:8197462-8197484 GGTTTATTGAGACTAGAGAATGG - Intergenic
1036376588 8:8205957-8205979 GGTTTATTGTGACTAGAGAATGG - Intergenic
1036385779 8:8279555-8279577 GTTGTGGTGAGACTAGAAGAAGG - Intergenic
1036846047 8:12171410-12171432 GGTTTATTGAGACTAGAGAATGG - Intergenic
1036852950 8:12217181-12217203 GGTTTATTGTGACTAGAGAATGG + Intergenic
1036853860 8:12225682-12225704 GGTTTATTGAGACTAGAGAATGG + Intergenic
1036867412 8:12413729-12413751 GGTTTATTGAGACTAGAGAATGG - Intergenic
1036874323 8:12459703-12459725 GGTTTATTGTGACTAGAGAATGG + Intergenic
1036875231 8:12468192-12468214 GGTTTATTGAGACTAGAGAATGG + Intergenic
1036894678 8:12624360-12624382 GGTTTATTGAGACGAGAGAATGG - Intergenic
1037165812 8:15827082-15827104 GGAGTCAAGAGACTAGAAATAGG - Intergenic
1037634308 8:20687353-20687375 TATGTAATGAGAGCAGAAAAAGG - Intergenic
1037904522 8:22707801-22707823 GGAGAAATGAGAGTTGAAAATGG - Intergenic
1039674616 8:39647707-39647729 GGTTTATTGAGTCTAGAGAATGG + Intronic
1040340964 8:46440639-46440661 GGTTTATTGAGACTAGAGAATGG + Intergenic
1040343247 8:46456228-46456250 GGTTTACTGAGACTAGAGAACGG + Intergenic
1040988857 8:53327541-53327563 GGTGTTATGACATTATAAAATGG + Intergenic
1042151897 8:65796188-65796210 GGAGTAATTAGACTCCAAAAAGG + Intronic
1042204414 8:66313775-66313797 GGTTTATTGAGACTAGAGAATGG + Intergenic
1043325415 8:79044518-79044540 GGACTAATGAAACTAGAAAGAGG + Intergenic
1044429699 8:92094949-92094971 GGTTTAAAGAGACTCGATAAAGG - Intronic
1044773369 8:95661313-95661335 GGTTTGATGAGGCTAGAAGAAGG - Intergenic
1046256994 8:111713008-111713030 GGTGTAGGGATACTAGAGAAAGG - Intergenic
1047795802 8:128254367-128254389 TGTGGAAAGAGACTAGAACAAGG + Intergenic
1049506239 8:143001037-143001059 GGTTTATTGAGACTAGAGAATGG - Intergenic
1049725874 8:144145985-144146007 GGTTTATCGAGACTAGAGAATGG - Intergenic
1049867700 8:144949710-144949732 GGTTTATTGAGACTGGAGAATGG - Intronic
1050385262 9:5082728-5082750 GGTTTATTGAGACTGGAGAATGG + Intronic
1051856601 9:21574457-21574479 GGAGTAATGAGAATGGAGAATGG - Intergenic
1051996022 9:23219341-23219363 GGTGAAGTGAGAAGAGAAAAAGG + Intergenic
1052211021 9:25903452-25903474 GGCGTAAAAAGAGTAGAAAAAGG + Intergenic
1052469841 9:28880475-28880497 GGTTTATTGAGACTAGAGAATGG - Intergenic
1053708642 9:40782213-40782235 GGTTTATCGAGACTAGAGAATGG + Intergenic
1053736363 9:41105445-41105467 GGTTTATTGAGACTAGAGAATGG - Intergenic
1054418552 9:64903008-64903030 GGTTTATCGAGACTAGAGAATGG + Intergenic
1054692010 9:68325955-68325977 GGTTTATTGAGACTAGAGAATGG + Intergenic
1055064277 9:72102873-72102895 GATGATATGAGACTAGAAGAAGG + Intergenic
1055540914 9:77304146-77304168 GGTTTATTGAGACTAGAGAATGG + Intronic
1056639596 9:88359144-88359166 GGTTTACAGACACTAGAAAATGG - Intergenic
1058812383 9:108653309-108653331 GGTGAAATAAGTATAGAAAAAGG + Intergenic
1058950670 9:109901071-109901093 GGTGGAACCAGACTGGAAAATGG + Intronic
1060676217 9:125517483-125517505 GTTGTAACAAGACTAGAAATGGG - Intronic
1060831026 9:126716782-126716804 GGTTTACTGAGACTAGAGAATGG - Intergenic
1061154639 9:128850500-128850522 GGTTTATTGAGACTAGAGAATGG - Intronic
1061155258 9:128856716-128856738 GGTTTATTGAGATTAGAGAATGG - Intronic
1203363865 Un_KI270442v1:240663-240685 CGTTTATTGAGACTAGAGAATGG + Intergenic
1185444767 X:251851-251873 GGTTTATTGAGACTAGAGGATGG + Intergenic
1185575776 X:1171177-1171199 GGTTTATTGAGACTAGAGAATGG - Intergenic
1187364176 X:18652765-18652787 GGTGAAATGAGTATAGAAACAGG - Intronic
1187990989 X:24872097-24872119 GTTGTAATTAGACCAAAAAAAGG + Intronic
1189208812 X:39265532-39265554 CAGGTAAGGAGACTAGAAAAAGG - Intergenic
1190650236 X:52562643-52562665 GGAGAAATGGGACTAGCAAATGG - Intergenic
1191102483 X:56746848-56746870 GATGTAATGACAAAAGAAAATGG - Intergenic
1193602288 X:83522290-83522312 TTTGTAATGAGAATACAAAATGG + Intergenic
1194219193 X:91170550-91170572 GGTTTATTAAGACTAGAGAATGG - Intergenic
1197314004 X:124941557-124941579 GGAGTACTGGGGCTAGAAAATGG - Intronic
1197509518 X:127354205-127354227 GGTTTATTGAGACTAGAGAATGG - Intergenic
1199203957 X:145125318-145125340 GTTGTAAAGATACCAGAAAATGG - Intergenic
1199512417 X:148637337-148637359 GGAGAAATGAAAATAGAAAAGGG + Intronic
1200245403 X:154521440-154521462 GGTTTATTGAGACTAGAGAATGG - Intergenic
1200555711 Y:4634307-4634329 GGTTTATTAAGACTAGAGAATGG - Intergenic
1200752480 Y:6959121-6959143 GGTTTATTGAGACTAGAGAATGG + Intronic
1201452678 Y:14133460-14133482 GGTTTATTGAGACTAGAGAATGG - Intergenic