ID: 917627065

View in Genome Browser
Species Human (GRCh38)
Location 1:176856972-176856994
Sequence TGAGTATTCCACACCTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917627064_917627065 -5 Left 917627064 1:176856954-176856976 CCTAAATAGTCTGAACTTTGAGT 0: 1
1: 0
2: 0
3: 15
4: 177
Right 917627065 1:176856972-176856994 TGAGTATTCCACACCTATTTTGG 0: 1
1: 0
2: 1
3: 10
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917627065 Original CRISPR TGAGTATTCCACACCTATTT TGG Intergenic
900949636 1:5851151-5851173 TTTGTATTCCACATCTAATTAGG + Intergenic
903816817 1:26069912-26069934 TGAGTATTCCACAGCCTCTTAGG - Intergenic
905584720 1:39107185-39107207 TGAGATTTCTTCACCTATTTTGG - Intronic
909856662 1:80542150-80542172 TGAAAATTCTACACATATTTGGG - Intergenic
909886997 1:80954162-80954184 TAAGTGTTCCAAACATATTTAGG + Intergenic
911823524 1:102449779-102449801 TGAGTGTTCCTCTCCAATTTTGG - Intergenic
911955283 1:104225821-104225843 TGAATATTGCTCACCTATATTGG + Intergenic
912006705 1:104911971-104911993 TGAGTAATAAACACCTATTATGG + Intergenic
916157643 1:161871068-161871090 TGAGTAGTCAACATTTATTTAGG - Intronic
917627065 1:176856972-176856994 TGAGTATTCCACACCTATTTTGG + Intergenic
922120414 1:222661721-222661743 TGAGTATTATAGACATATTTAGG - Intronic
1065425219 10:25595778-25595800 TGAATATTCCAAAACTATTCTGG + Intronic
1066587173 10:36948684-36948706 TGGGTATTCAACACCAACTTGGG + Intergenic
1068619182 10:59159994-59160016 TCATTAGTCCATACCTATTTTGG + Intergenic
1069221872 10:65893455-65893477 TGAGTATTTCCCTCCTATATTGG - Intergenic
1070726125 10:78792224-78792246 TCACTATCCCACACCTATCTTGG + Intergenic
1076366832 10:129926672-129926694 TGTTTATTCCACACCTTTTTTGG - Intronic
1081015734 11:37877611-37877633 TGAATATTCCACATGTCTTTAGG - Intergenic
1085846703 11:80074272-80074294 TGAGTCATCCAGACCCATTTTGG + Intergenic
1086947368 11:92856389-92856411 TGAGTATTTCACATGTAATTAGG - Intronic
1087595350 11:100247162-100247184 TGCCTATTTAACACCTATTTAGG - Intronic
1088334491 11:108688608-108688630 TTAGTATTCCACATCTCATTAGG - Intronic
1092566175 12:9668004-9668026 TGAGATTTCCACACTTATCTTGG - Intronic
1095277687 12:40308188-40308210 TTAGTATTGCAAACATATTTTGG + Intronic
1095484338 12:42669075-42669097 TGAGTAATCCACATCAATTTTGG - Intergenic
1095612757 12:44149542-44149564 TGCTTATTGCACACTTATTTAGG + Intronic
1097813041 12:64039250-64039272 TGAGTATTCTCTACCTAGTTCGG - Intronic
1098556439 12:71824205-71824227 TCAGTATTCCACAGCAATGTTGG - Intergenic
1102478288 12:113202859-113202881 TGACTAAGCCACAGCTATTTTGG + Intronic
1102739198 12:115191762-115191784 TGAATATTCAACAACTTTTTAGG + Intergenic
1115810290 14:37099546-37099568 TTATTATTCCTCACCCATTTTGG + Intronic
1116606045 14:46996846-46996868 TGAGCTTTCCACACATATTCTGG + Intronic
1119588393 14:75860601-75860623 TGAGATTTCCACACCAATTAGGG - Intronic
1120726529 14:87947996-87948018 TGAGTTTTCCACAAATGTTTAGG - Intronic
1121891270 14:97593444-97593466 TGACTATTCCTCACATCTTTGGG + Intergenic
1127412225 15:58720943-58720965 TGTGGATTCCACTCCTTTTTCGG + Intronic
1127759198 15:62121409-62121431 TGAATATTCCACCCCTTGTTTGG - Intergenic
1131028723 15:89168236-89168258 TGAGTATTGCACGGCCATTTTGG - Intronic
1133042565 16:3068241-3068263 TGAGTATGACACACCCATCTGGG + Intronic
1142788616 17:2245318-2245340 TGACTATTCCACTCCAGTTTTGG + Intronic
1144636703 17:16914459-16914481 TTGGAATTCCACACCAATTTGGG - Intergenic
1156714415 18:39989789-39989811 TCAGTGTTCCACATATATTTGGG + Intergenic
1157412065 18:47471419-47471441 TGAGGATTCCTCCCCTTTTTAGG - Intergenic
928079313 2:28295126-28295148 TGATTTTTTCCCACCTATTTTGG - Intronic
930252508 2:49050717-49050739 CAATTATTCCACACCTATTCTGG - Intronic
930291230 2:49495330-49495352 TGATTTTTCTTCACCTATTTAGG - Intergenic
930321622 2:49861923-49861945 TGAGGAATCCACACCTAATAAGG + Intergenic
934953792 2:98599541-98599563 TGAGAATTCCACAGCAATATGGG - Exonic
936491941 2:112979434-112979456 GGAGAATTTCACACCTAATTGGG + Intronic
936492376 2:112983451-112983473 GGAGGATTCCAAACCGATTTTGG + Intronic
938631702 2:133174633-133174655 TGAGAAATCCCCATCTATTTGGG + Intronic
938833116 2:135073125-135073147 TAAATATTCCACACCCCTTTGGG - Intronic
939487877 2:142839591-142839613 TTAGTATTGCCCAGCTATTTAGG + Intergenic
941452616 2:165677908-165677930 TCAATATTCCAAAACTATTTTGG - Intronic
944279769 2:197882179-197882201 TTAATATTCCACACCAAATTAGG - Intronic
945765764 2:213975706-213975728 AGAGTTTTTCTCACCTATTTTGG - Intronic
947239100 2:227974970-227974992 AGAGTTTTCCTCACCTCTTTGGG + Intergenic
1174948691 20:55018717-55018739 TGAATTTTCAACACCTAGTTGGG + Intergenic
1176946295 21:14986345-14986367 TCAGTATTCAAGACTTATTTGGG - Intronic
1177115919 21:17087113-17087135 TAAATCTACCACACCTATTTTGG - Intergenic
1182957489 22:34440654-34440676 TAAGAATTCCAGACATATTTTGG - Intergenic
949842196 3:8331861-8331883 TGAGTAGACCTCACCTGTTTTGG - Intergenic
960322544 3:116254093-116254115 AGAGTATTCCACATATATTTAGG - Intronic
969632058 4:8344501-8344523 AGAGCATGCCACACATATTTGGG + Intergenic
970715336 4:18915251-18915273 TGAATCTTCCACACCTGCTTTGG - Intergenic
971624611 4:28902567-28902589 AGGATATTCAACACCTATTTAGG + Intergenic
971733246 4:30413251-30413273 TGAGTTTTCCAAACCACTTTTGG - Intergenic
974189701 4:58488847-58488869 GGAGTAGTCCCTACCTATTTGGG + Intergenic
975914261 4:79304845-79304867 TGAGTATGCTATACCTGTTTGGG + Intronic
976287288 4:83382987-83383009 TGAGGGTTCCTCACCTTTTTAGG + Intergenic
977249060 4:94668645-94668667 TGACTATTCCACAACTAGGTAGG + Intergenic
980991742 4:139744109-139744131 AGAGTATTCCAGACCTCTCTAGG - Intronic
981827134 4:148956111-148956133 TGAGTCAACCACACCTCTTTAGG - Intergenic
982424051 4:155236148-155236170 TGCATCTTCCACACCTATTTTGG + Intergenic
983119015 4:163857355-163857377 TGAGTACTCCAGACCTGTGTAGG - Intronic
984673468 4:182518871-182518893 TGAGAATCCCAAACCTATTAAGG + Intronic
991335436 5:65541459-65541481 TGAGAATTCCCCACACATTTTGG + Intronic
991629726 5:68644513-68644535 TGAGCTTTCCATACCTCTTTGGG + Intergenic
993143359 5:84062563-84062585 TGAGTATTCCTCCTCTAATTAGG + Intronic
1000728191 5:164799164-164799186 TGATTATCACACACTTATTTTGG - Intergenic
1008273165 6:49513492-49513514 TGAGCATTCCAATCATATTTAGG + Intronic
1013865829 6:114694939-114694961 TGAGTGTTCCACTCATATTTTGG + Intergenic
1015333978 6:132013991-132014013 TGATTCTTCCACACGTCTTTCGG + Intergenic
1015712163 6:136154018-136154040 CTAGTATACCACTCCTATTTGGG + Intronic
1017764398 6:157594797-157594819 TGTCCATTCCACACCTATCTTGG + Intronic
1020560450 7:9724910-9724932 TTAGTTTTCCACATCCATTTTGG - Intergenic
1020649984 7:10862604-10862626 TGAGTTTTCTACTTCTATTTTGG - Intergenic
1021341584 7:19469785-19469807 TGATGATTCCACATCAATTTTGG - Intergenic
1021668443 7:23012159-23012181 TTAGTATTCAAGACCTATTTTGG - Intronic
1028225593 7:88248953-88248975 TGTGTATTCCACAGCTGTTGGGG + Intergenic
1030483539 7:110135877-110135899 TGAATATTCCACAACTATTTCGG - Intergenic
1032220690 7:129991866-129991888 AAAGTATTCCACAGCTACTTGGG - Intergenic
1036136998 8:6171462-6171484 TGAGTTTTCCACAATTATTTTGG - Intergenic
1042710206 8:71708652-71708674 TGAGTAATGCACACCTATTGGGG + Intergenic
1043672696 8:82907900-82907922 TGATTATTTCATACCTATTTAGG - Intergenic
1053474350 9:38371266-38371288 TGTGATTTCCCCACCTATTTGGG + Intergenic
1056214725 9:84396481-84396503 TGTATATTTTACACCTATTTAGG - Intergenic
1056882028 9:90404033-90404055 AGAGTATTCCACAAGTATTTGGG + Intergenic
1186496875 X:10017984-10018006 TGAACATTCCATACATATTTCGG - Intronic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1192162850 X:68801528-68801550 TGAGTGTTCAACAAATATTTTGG - Intergenic
1192875420 X:75224520-75224542 TGAGTATTCCACAGTTACCTTGG + Intergenic
1193545127 X:82817493-82817515 TGAATATTCCACTCCTATCCTGG + Intergenic
1198846971 X:140922910-140922932 TGAATAATCCACCCCTAGTTCGG - Intergenic
1199326774 X:146507912-146507934 TGTGTAGTGCACACATATTTAGG - Intergenic