ID: 917627671

View in Genome Browser
Species Human (GRCh38)
Location 1:176862438-176862460
Sequence GTCCTCTGTGCAGTGGAAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 258}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917627671_917627674 0 Left 917627671 1:176862438-176862460 CCTCCTTCCACTGCACAGAGGAC 0: 1
1: 0
2: 1
3: 20
4: 258
Right 917627674 1:176862461-176862483 ATGTCCATGCCACAGATGCTTGG 0: 1
1: 0
2: 0
3: 11
4: 146
917627671_917627679 19 Left 917627671 1:176862438-176862460 CCTCCTTCCACTGCACAGAGGAC 0: 1
1: 0
2: 1
3: 20
4: 258
Right 917627679 1:176862480-176862502 TTGGGAAAGGTAAAGCTCTCTGG 0: 1
1: 0
2: 1
3: 20
4: 167
917627671_917627680 20 Left 917627671 1:176862438-176862460 CCTCCTTCCACTGCACAGAGGAC 0: 1
1: 0
2: 1
3: 20
4: 258
Right 917627680 1:176862481-176862503 TGGGAAAGGTAAAGCTCTCTGGG 0: 1
1: 0
2: 2
3: 19
4: 202
917627671_917627681 24 Left 917627671 1:176862438-176862460 CCTCCTTCCACTGCACAGAGGAC 0: 1
1: 0
2: 1
3: 20
4: 258
Right 917627681 1:176862485-176862507 AAAGGTAAAGCTCTCTGGGCAGG 0: 1
1: 0
2: 1
3: 26
4: 175
917627671_917627675 1 Left 917627671 1:176862438-176862460 CCTCCTTCCACTGCACAGAGGAC 0: 1
1: 0
2: 1
3: 20
4: 258
Right 917627675 1:176862462-176862484 TGTCCATGCCACAGATGCTTGGG 0: 1
1: 0
2: 0
3: 10
4: 130
917627671_917627677 6 Left 917627671 1:176862438-176862460 CCTCCTTCCACTGCACAGAGGAC 0: 1
1: 0
2: 1
3: 20
4: 258
Right 917627677 1:176862467-176862489 ATGCCACAGATGCTTGGGAAAGG 0: 1
1: 1
2: 0
3: 28
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917627671 Original CRISPR GTCCTCTGTGCAGTGGAAGG AGG (reversed) Exonic