ID: 917628775

View in Genome Browser
Species Human (GRCh38)
Location 1:176872822-176872844
Sequence GTGGCTTGGGAAGAAGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 502}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917628775 Original CRISPR GTGGCTTGGGAAGAAGGTGA GGG (reversed) Intronic
901317060 1:8316584-8316606 GAGGCCTGGGAAGGAGGTGAGGG - Intergenic
901806359 1:11741085-11741107 GTGGCTGGAGTGGAAGGTGAGGG - Intronic
901881914 1:12199111-12199133 GTGGCTTGGGAGGAGGGAGGTGG + Intronic
902400677 1:16155254-16155276 GCGGCTTGGGAAGGAGGGAAAGG + Intronic
902518892 1:17004818-17004840 CAGGCTGGGGAAGCAGGTGAGGG + Exonic
902548548 1:17205682-17205704 GGGGCTTGGCAAGAAATTGAGGG - Intronic
902572503 1:17355894-17355916 GGGGCTTGGCAAAAAGGTCAGGG - Intronic
902659276 1:17890181-17890203 AGGTCTTGGGAAAAAGGTGAGGG + Intergenic
902690171 1:18106097-18106119 GCAGCCTGAGAAGAAGGTGAGGG + Intergenic
902706394 1:18208214-18208236 GTGGGTTATGAAGAAGGTGAAGG - Intronic
902706514 1:18209019-18209041 GTGACTGGGGAGGAAGGAGAAGG + Intronic
902768160 1:18630576-18630598 GGGGCTGGGGGAGAAGGGGAGGG - Intergenic
902777499 1:18684152-18684174 ATTGCTGGGGAAGAAGGTGGTGG + Intronic
902901245 1:19517813-19517835 GTGTCTTGGGAAGGACGTGGTGG - Intergenic
903036182 1:20494107-20494129 ATAGCTAGGGAAGACGGTGAGGG + Intergenic
903341873 1:22659689-22659711 GTGACTTGGGAGGCAGGAGACGG - Intronic
903709288 1:25310601-25310623 GTGGCTTTGGAACTGGGTGATGG + Intronic
903717830 1:25381824-25381846 GTGGCTTTGGAACTGGGTGATGG - Intronic
904388462 1:30163056-30163078 GTGGTATGAGAGGAAGGTGAAGG + Intergenic
904500421 1:30909573-30909595 GCCGCTGGGGATGAAGGTGAAGG - Intergenic
905181913 1:36172480-36172502 GTGGCTGGAGAAGGAGGAGAAGG + Exonic
905371045 1:37482883-37482905 CTGGACTGGGATGAAGGTGAAGG - Exonic
905462910 1:38133233-38133255 GGGGATGGGGAAGAAGGGGAGGG + Intergenic
907306741 1:53517531-53517553 GTGGCTGAGGAAGAAGGTGCAGG - Intronic
907977725 1:59448369-59448391 GTGTCTTGGGCAGTAGGTGGTGG + Intronic
908201502 1:61800721-61800743 GTGGGGTGGGAAGAAGGGGAGGG - Intronic
908267447 1:62393387-62393409 GTGGCTTGGGAAGAAGCTGTTGG - Intergenic
908897732 1:68919312-68919334 TTGGCTTGGGAAGGAAGGGATGG - Intergenic
910630298 1:89346856-89346878 GTGGCTTGGCTAGATGGTCAGGG + Intergenic
910927691 1:92413221-92413243 GTGGCTGTGGCAGTAGGTGATGG - Intergenic
911489925 1:98551729-98551751 GGGGCTTGGGAATGAGGTGGTGG + Intergenic
911830657 1:102546707-102546729 GTGGCTTTGGAAGTGGGTAATGG - Intergenic
912410290 1:109476557-109476579 GTGGGTTGGGGAGCAGCTGAGGG + Intronic
912502692 1:110132743-110132765 GTGGCTGGAGCAGAAGATGAGGG - Intergenic
912522366 1:110254334-110254356 GAGGCTTGGGAGGATGGTCAGGG + Intronic
912734744 1:112140277-112140299 GTGGTTTGGGAAGGAGATTAGGG - Intergenic
913219729 1:116649721-116649743 GGGCCTTGGGAAGAAGGATAAGG - Intronic
913395391 1:118364746-118364768 GTGGGTTGATAACAAGGTGAGGG - Intergenic
913572418 1:120134020-120134042 GAAGGTTGGGAGGAAGGTGAGGG - Intergenic
914449407 1:147777491-147777513 AAGACTTGTGAAGAAGGTGATGG - Intergenic
914454876 1:147826636-147826658 GAAGCGTGGGAAGAGGGTGAGGG - Intergenic
914802954 1:150974142-150974164 GTGGCTTGGGTGGGAGGAGAGGG - Intronic
915275519 1:154785422-154785444 GGCCCTTGGGAAGGAGGTGAAGG - Intronic
915278630 1:154807344-154807366 GTGGCTTGGGAAGGAGCAGCTGG - Intronic
915593392 1:156883024-156883046 AGGGCTTGGGAACATGGTGAGGG + Intergenic
915783566 1:158581829-158581851 GTGGCTTAGGAATAAGCAGAAGG - Intergenic
916035554 1:160919358-160919380 GTGGGTGGGGAAAAAGGGGAGGG - Intergenic
916733886 1:167590021-167590043 GTGTCTTGGGAAGAACCTGGTGG + Intergenic
917628775 1:176872822-176872844 GTGGCTTGGGAAGAAGGTGAGGG - Intronic
918739096 1:188104261-188104283 GTGGCTTTGGAACTAGGTAATGG - Intergenic
919534720 1:198773553-198773575 GTGGCTTCAGAACAAGGTGAGGG - Intergenic
919755515 1:201063780-201063802 GTTGCTGGAGCAGAAGGTGAAGG + Intronic
1065897740 10:30179239-30179261 GTGGCTAAGACAGAAGGTGAGGG + Intergenic
1066805716 10:39250683-39250705 GTGGAGTGGGAAGAGGGGGAGGG - Intergenic
1067082195 10:43218071-43218093 GTCGCCTGGGAAGCAGGTGCTGG - Intronic
1068296485 10:55078765-55078787 GGGGTTTGGGAAGGGGGTGAGGG - Intronic
1068739331 10:60451081-60451103 GAGGCACGGGAGGAAGGTGAAGG + Intronic
1068855655 10:61795039-61795061 GAGGGTGGAGAAGAAGGTGAGGG - Intergenic
1069441551 10:68433239-68433261 GTGGGTTGGGGAGAGGATGAGGG - Intronic
1069903633 10:71719875-71719897 CTGGGTTGGGAAGAGGGAGAGGG + Intronic
1071798090 10:89027424-89027446 GTGTCATGGGAAGGACGTGATGG + Intergenic
1072290705 10:93961868-93961890 GTGGCTAGGGAGGACGGAGAGGG - Intergenic
1072618323 10:97064089-97064111 GTGGGTGGGGCAGGAGGTGAAGG - Intronic
1073204504 10:101761799-101761821 GTGGCTTGGTGTGAGGGTGAGGG - Intergenic
1074442814 10:113493857-113493879 GAGGCTTGGGAAGCAGCCGAGGG - Intergenic
1074476800 10:113781390-113781412 GGGGTTTGGGAAGGAGGTGTTGG - Intronic
1074476836 10:113781500-113781522 GGGGTTTGGGAAGGAGGTGTTGG - Intronic
1074476890 10:113781688-113781710 GGGGTTTGGGAAGGAGGTGTTGG - Intronic
1075823518 10:125334243-125334265 GTGGGTGGGGGAGAAGGTGAGGG + Intergenic
1076170128 10:128312225-128312247 GTCACTTGGGCAGAAGATGACGG + Intergenic
1076482724 10:130795488-130795510 GTGGCCTGGGAGGATGGTGAGGG - Intergenic
1076603552 10:131674873-131674895 GAGGCATGGAAAGAAGGTCAAGG + Intergenic
1076947322 10:133660133-133660155 ATGGCTTAGGAAGCAGGGGATGG + Intergenic
1077114637 11:877972-877994 GTGGCTTTCTAAGAAGGGGAAGG + Intronic
1077164529 11:1129143-1129165 GTGGCTTGGGACGAAGGCCTCGG + Intergenic
1077318441 11:1929432-1929454 GGGGCTTGGGAGAAAGGGGAGGG - Intronic
1077633149 11:3824515-3824537 GGGGCTTGGGAACAAACTGAGGG + Intronic
1078413823 11:11149102-11149124 GTGGGATGGGAAGAAGGAGCGGG + Intergenic
1078889606 11:15542623-15542645 GTGGCTATAGAAGAAGGTCATGG - Intergenic
1078918495 11:15804023-15804045 GTGAGTTGGGAAGAAGATTATGG + Intergenic
1079097989 11:17523160-17523182 GGGGCTGGGGATGAAGGTCAAGG + Intronic
1079282076 11:19096581-19096603 GAGACTGGGGTAGAAGGTGAGGG + Intergenic
1080416950 11:32077782-32077804 GTGGCCTGGATAGAGGGTGATGG - Intronic
1081618146 11:44602724-44602746 CTGACTTAGGAAGTAGGTGAGGG - Intronic
1083056910 11:59830612-59830634 ATTTCTTGGGATGAAGGTGATGG + Intronic
1083674312 11:64317023-64317045 GTGGCCCGGGAAGCAAGTGATGG + Intronic
1084147683 11:67273735-67273757 GTGGGCTGGGAAGAATGTGGTGG + Intronic
1084187831 11:67484202-67484224 GTGGCGTTGGAAGAAGGGGCTGG + Intronic
1084458001 11:69279509-69279531 GTGGCTGGTGAGTAAGGTGATGG - Intergenic
1084692646 11:70736016-70736038 GTGGCTGTGGAGGAAGGCGATGG - Intronic
1085034480 11:73291914-73291936 GTGGCATGGGAGGATGGTGTGGG - Intronic
1085454242 11:76656760-76656782 GTGGCCTGGGAGGGAGGAGATGG + Intergenic
1085676560 11:78525662-78525684 GGGGTTTGGGAAGAGGGAGATGG - Intronic
1086120394 11:83299561-83299583 GTGTCATGGAAAGGAGGTGAGGG + Intergenic
1086928127 11:92663000-92663022 CTGGCTTAGGAAGACTGTGATGG + Intronic
1087158451 11:94926725-94926747 GGGGGTGGGGAAGAAGATGAAGG - Intergenic
1087480848 11:98698856-98698878 GTGGCTTTGGAAGTTGGTAATGG - Intergenic
1087735545 11:101828601-101828623 GTGGCTTTGGAACTAGGTGATGG - Intronic
1088972971 11:114789746-114789768 GTGTCATGGGAAAAAGGAGAGGG - Intergenic
1089375504 11:117991525-117991547 GTGGATAGGGAACAAGGAGAGGG - Intronic
1089671790 11:120062032-120062054 GTGGCTGGGGAACAAGCGGAGGG + Intergenic
1090400791 11:126447146-126447168 GGGGCCTGGGAAGAAGGTGCTGG + Intronic
1091697040 12:2634765-2634787 GTGGCTGGAGGAGAAGGTGGAGG - Intronic
1092056349 12:5511364-5511386 ATGACTTGGAAAGGAGGTGAGGG + Intronic
1092330082 12:7578746-7578768 GTAGGTTGGGAAGGGGGTGAGGG - Intergenic
1092480667 12:8856500-8856522 CTGGCTTGGGAAGTATATGAAGG + Intronic
1094423437 12:30295997-30296019 GTGGCTTGGGAAGAAGGCCCAGG - Intergenic
1095843026 12:46715109-46715131 GTGGCTTTGGAACTAGGTAATGG - Intergenic
1095886439 12:47193445-47193467 GAGGGTTGGGGAGAAGGTGATGG - Intronic
1096111998 12:49034379-49034401 GGGGCGTGGGAGGAAGGTGCAGG - Intronic
1096464120 12:51838757-51838779 GTGGCCTGGGAAAGAGGTGGGGG + Intergenic
1096548034 12:52354725-52354747 GTGGGTTGGGAAGACAATGAAGG - Intergenic
1096779477 12:53983889-53983911 TTCGCTTTGGAAGAAGGCGATGG + Intergenic
1096885655 12:54716688-54716710 GTGGCTGGAGCAGAAGGCGAGGG + Intergenic
1097012252 12:55961523-55961545 GTAGCTTGGGAAGAAAAGGAGGG - Intronic
1098029209 12:66236969-66236991 GTGGCTGGTAAAGAAGGGGAAGG - Intronic
1098058671 12:66536560-66536582 ATGACTTGTGAAGGAGGTGAGGG - Intronic
1098075905 12:66730748-66730770 GTGTGCTGGGGAGAAGGTGACGG + Intronic
1098154508 12:67583446-67583468 GTGGCTTGGGGGTAAGGAGACGG + Intergenic
1098831823 12:75373461-75373483 GTGGTTTGGGTAGATGGTCAGGG - Intronic
1099872057 12:88361850-88361872 GTGGATTGGGAACAGGGTGTGGG + Intergenic
1100654816 12:96630880-96630902 TTGGCTTGGCATGAAGGTGGTGG + Intronic
1100671194 12:96814696-96814718 GTGGGTTGGGGACAAGGGGAAGG - Intronic
1101418452 12:104529126-104529148 GAGGCTGGGGAAGGAGATGAGGG + Intronic
1101969589 12:109303654-109303676 GTGGCCCTGGGAGAAGGTGAGGG + Intronic
1103192486 12:119013925-119013947 CTGGGTTGGGAAGAAGGGGAGGG - Intronic
1103705956 12:122872580-122872602 GTGGGTGGGGAAGCGGGTGACGG - Intronic
1103884482 12:124190395-124190417 CTGGAATGGAAAGAAGGTGATGG - Intronic
1103955830 12:124576297-124576319 GTGCCCTGGGAAGAAGGGAAGGG - Intergenic
1104159031 12:126161188-126161210 GTGTCTAGGGAGGAAGGAGAGGG - Intergenic
1104844659 12:131840773-131840795 GTGGCCGGGGAAGAAGGCGTGGG - Exonic
1105763471 13:23534491-23534513 CAGGCTTGGGAAGACGGAGAAGG + Intergenic
1106158508 13:27179621-27179643 GGGACTTGGGAAGAAGGGCAGGG + Intergenic
1106199492 13:27524446-27524468 TGGCCTTGGGAGGAAGGTGACGG + Intergenic
1106385445 13:29281167-29281189 GAGGCTTGGGATGAAGGTAGAGG - Intronic
1106840856 13:33683658-33683680 GTGGGGAGGGGAGAAGGTGAGGG + Intergenic
1107452638 13:40524663-40524685 GTACCTTGGGAACAAGGTAAGGG + Intergenic
1107805921 13:44153886-44153908 GAGGCCTGGGAGGAAGGGGAAGG - Intronic
1108185079 13:47880576-47880598 GTGGCTCAGGAGGAAAGTGATGG + Intergenic
1110044674 13:70813071-70813093 GTGTCTTTGGAACTAGGTGATGG + Intergenic
1110169743 13:72486314-72486336 GTGGGTTTGGAAAAAGGTAAGGG - Intergenic
1110312141 13:74062832-74062854 GTGGGTTAGGAAAATGGTGATGG - Intronic
1110521351 13:76482011-76482033 GTGGCTTGGGCAGATGGTTGTGG - Intergenic
1110528170 13:76564104-76564126 CTTGTTTGGGAAGAAGGGGAAGG - Intergenic
1110667739 13:78137706-78137728 GTGGGTGGGGAAGAGGGGGAGGG - Intergenic
1111415131 13:87930344-87930366 GTGGCTAGGGTAGAAGGGGAAGG + Intergenic
1111607664 13:90561791-90561813 CTCTCTTGGGAAGAAGGGGAAGG + Intergenic
1113119059 13:106906808-106906830 GTGGCCTGGGTAGCAGGTAAAGG + Intergenic
1113270952 13:108673835-108673857 TTGGTTTGGGAAGAAGATGAGGG - Intronic
1113698725 13:112366875-112366897 GTGGCATGGGAACAGGCTGATGG + Intergenic
1113749711 13:112768796-112768818 GTGGCTTGGGAAGAATCTGGAGG + Intronic
1114459556 14:22877769-22877791 GTGGCGTGGGGAGCAGGTGGTGG - Exonic
1114522835 14:23349554-23349576 GAGGCTTGAGAAGATGGGGAGGG + Intronic
1115101094 14:29700933-29700955 ATGCCTTGGGAGGAAGGGGAGGG - Intronic
1118120091 14:62830290-62830312 GTGGCTTTGGAAGTGGGTAATGG - Intronic
1118307833 14:64670166-64670188 GTGACTTGGCAAGAGGCTGAGGG - Intergenic
1119380891 14:74227494-74227516 GGGGCTAAGGAAGAAGGGGAAGG + Intergenic
1119773610 14:77235964-77235986 GTGGCCTGGGGAGATGGTGATGG + Intronic
1119857099 14:77908920-77908942 GTGGCTTTGCAAGAAGGGGAAGG + Intronic
1119875799 14:78058129-78058151 GTTCCTTGGAAAGAAGGAGAGGG - Intergenic
1120763066 14:88303413-88303435 GTGGCTTGGAAAGAATGTGAGGG + Intronic
1120849808 14:89159691-89159713 GTGGGGTGGGATGAAGGTGGGGG + Exonic
1121471382 14:94156963-94156985 GTGGCTTAGGATGATGGTGACGG + Intronic
1121568440 14:94928329-94928351 GAAGGTTGGGAAGAGGGTGAGGG - Intergenic
1121573007 14:94961749-94961771 GTGGCCTGGGTAGCTGGTGATGG + Intergenic
1122606145 14:102948443-102948465 GTGGGTTTGGAGGGAGGTGAGGG + Intronic
1202921376 14_KI270723v1_random:32684-32706 ATGGCTTAGGAAGCAGGGGATGG + Intergenic
1202923534 14_KI270724v1_random:4896-4918 ATGGCTTAGGAAGCAGGGGATGG - Intergenic
1124674702 15:31674272-31674294 GAGGCTGGGGATGAAGGTGAGGG + Intronic
1124917207 15:33987545-33987567 CTGGCCTGAGAAGAAGGGGATGG - Intronic
1125492964 15:40161988-40162010 CTGGCATGGGATGAAGGTGGGGG + Intronic
1125554916 15:40576593-40576615 GTATCTTGGGATGAAGGTGGAGG - Intergenic
1125769343 15:42154522-42154544 GAGGCTAGGGCAGAAGGGGAAGG + Intronic
1125997287 15:44174904-44174926 GGGGGTTGGGAGGAAGGAGAGGG + Intronic
1127393038 15:58522214-58522236 GTGGCTGGGAGAGAAGGTGTAGG - Intronic
1127638570 15:60893955-60893977 GTGGGCTGTGAAGAAGATGAAGG - Intronic
1128210133 15:65892808-65892830 GTGGCTTGGGAAGCAGAAGGTGG + Intergenic
1129196828 15:73973434-73973456 GTGCCCTGGGAAGAAGGGCAAGG - Intergenic
1129681826 15:77662471-77662493 TTGGCTTTGAGAGAAGGTGAGGG - Intronic
1131028717 15:89168184-89168206 GGGGCTTGAGAAAAAGGTGAGGG + Intronic
1131377526 15:91937758-91937780 GTGGAAAGGGAAGAAGGGGAGGG + Intronic
1131834083 15:96373016-96373038 CTGGTTTGGGAAGTGGGTGATGG + Intergenic
1132452690 15:101976987-101977009 GTGACTCAGGAAGAAGGTGGGGG + Intergenic
1132454209 16:13639-13661 GTGACTCAGGAAGAAGGTGGGGG - Intergenic
1138050868 16:53776003-53776025 CTTGCTTGGGAAAAAGGGGATGG + Intronic
1139505231 16:67395218-67395240 GTGTCTGGGGAAGAGGGTGGTGG + Exonic
1140480326 16:75258951-75258973 GTGGCCTGGGAAGGAGGAGGAGG + Intronic
1140548389 16:75835237-75835259 GTGGCTTTGGAATTTGGTGATGG - Intergenic
1140659421 16:77173545-77173567 GTGAGTTGAAAAGAAGGTGAGGG - Intergenic
1140679995 16:77375632-77375654 GTGGCCTGCTAAGAAGGAGATGG + Intronic
1141185407 16:81783530-81783552 GGGGCTTGGGACTCAGGTGAGGG + Intronic
1141644738 16:85361450-85361472 GTGGCCTGGAAAGAGGGAGACGG - Intergenic
1141753951 16:85978897-85978919 ATGGCAGGGGAAGACGGTGAGGG + Intergenic
1141801078 16:86309708-86309730 GTCACTTGGGTAGAAGGTGAGGG - Intergenic
1142890019 17:2937182-2937204 GTGGAGTGGGAAGGAGGAGAGGG + Intronic
1143423179 17:6812160-6812182 CTGCCTTGTGAAGAAGGTGCTGG + Intronic
1143450422 17:7033290-7033312 GTGGCTTTGGAAGTGGGTGATGG - Intergenic
1143585771 17:7849454-7849476 GTGGGCTGGGCAGAAGGTGCAGG - Exonic
1143686140 17:8517631-8517653 GTGATTTGGGTAGAAGATGATGG - Intronic
1146560477 17:33864600-33864622 GGGGCTGGGGATGAAGGTGGAGG + Intronic
1146949008 17:36892819-36892841 TTGGCTTGGGGAGAGGGTCAGGG - Intergenic
1147646024 17:42034372-42034394 TTGGCTTGGGAAGCAGGGGTCGG + Intronic
1148155798 17:45424858-45424880 GAGGCCTGGGAAGAAAGTGAGGG + Intronic
1148741802 17:49897351-49897373 GAGGGCTGGGGAGAAGGTGAAGG - Intergenic
1149649807 17:58269628-58269650 GTGGCAGGGGTGGAAGGTGAGGG + Intergenic
1150130564 17:62666677-62666699 GTGGGTTGGGGAGAGGGCGATGG + Intronic
1150387487 17:64773514-64773536 GAGGCCTGGGAAGGAAGTGAGGG + Intergenic
1151184091 17:72350856-72350878 CATGCTTGGGAAGAAGGTAAGGG - Intergenic
1151190177 17:72392633-72392655 GTGGGTTGGGGAGATGGAGAGGG - Intergenic
1152077939 17:78170073-78170095 GTGACTTGGGCTGAAGGTGACGG + Intronic
1152693581 17:81733002-81733024 GTGGCCTGGGCAACAGGTGAGGG - Intergenic
1153116545 18:1664049-1664071 AGAGCTTGGGTAGAAGGTGAAGG - Intergenic
1153564042 18:6401458-6401480 GTGGTTTGGGAAGAGGATGAGGG - Intronic
1153581404 18:6577635-6577657 GTGGCTTTATAAGAAGGGGAAGG - Intronic
1153795360 18:8616961-8616983 ATGGCTTGGGAAGACAGTGGTGG - Intronic
1154007013 18:10539512-10539534 GGGGCTGGGGAATAAGGGGAGGG + Intronic
1155260627 18:24038875-24038897 GTGGCTTTATAAGAAGGGGAAGG - Intronic
1155501546 18:26491756-26491778 TTGGCTAGGGAATAAGGTGAAGG + Intronic
1155596912 18:27498684-27498706 GTGGTTTGGCAAGAAGGTGGAGG - Intergenic
1156036217 18:32770547-32770569 GTGGCTGGGGTCGAAGGTGGAGG + Exonic
1157814352 18:50720236-50720258 GTGGCTTTGAGAGAAGCTGATGG - Intronic
1160794842 19:940562-940584 GGGGCCTGAGAAGAAGGAGAAGG + Intronic
1161354211 19:3810201-3810223 GTGGCTGGTGGAGAAGGTGTGGG + Intronic
1161848090 19:6723841-6723863 GTGGCTTGAGGAGAAAGTGGGGG - Intronic
1162327205 19:10006359-10006381 GTGGCTCAGGAAGAAGGAGCCGG + Intronic
1163131031 19:15273110-15273132 GTGCCTGGTGAAGAATGTGATGG - Exonic
1163169178 19:15518907-15518929 GTGGGTTGGGATGATGGGGATGG + Intronic
1164441361 19:28282819-28282841 GTGGGATGGGAAGAAGATGGTGG - Intergenic
1165185381 19:34016153-34016175 GAGGTTTAGGAAGAAAGTGAAGG - Intergenic
1165188755 19:34044478-34044500 GTGGCTTTGGAATAAGGTAATGG + Intergenic
1165529411 19:36385473-36385495 GTGGCTTTGGAACTAGGTAATGG + Intronic
1166822630 19:45589929-45589951 AAGGTTTGGGAAGAAGGTGTGGG - Exonic
1167381743 19:49142299-49142321 GTGGCAGGGGCAGAAGGAGAAGG - Intronic
1167407669 19:49324523-49324545 GTTGCTTGGGATGACGGTGTAGG - Intronic
1167485885 19:49762816-49762838 GTGGGGAGGGAAGAAGGAGAAGG - Intronic
1167521445 19:49958451-49958473 GTGGCTTGGGGAGGAGCTGCTGG - Exonic
1167703506 19:51065102-51065124 GGGGCCTGAGGAGAAGGTGAAGG + Exonic
1167756134 19:51414989-51415011 GTGGCTTGGGGAGGAGCTGCTGG - Exonic
925118393 2:1398972-1398994 GTGGCTTGCAGAGGAGGTGAGGG - Intronic
925587197 2:5475559-5475581 GGGGCCTGGGAAGAGGGAGAGGG + Intergenic
927081798 2:19637721-19637743 TTGGTTTGGCCAGAAGGTGATGG - Intergenic
927629991 2:24764783-24764805 TCATCTTGGGAAGAAGGTGAAGG + Intronic
927648959 2:24899256-24899278 GTGGTTTGGGGAGAAGGAGGCGG - Intronic
928301339 2:30127958-30127980 GGGGTATGGGAAGAGGGTGAAGG - Intergenic
928445513 2:31330450-31330472 GAGGCTCGGGGAGAAGATGATGG - Intergenic
928935625 2:36674577-36674599 CTGGCTTGGGGAGAAGGGGTCGG - Intergenic
929077114 2:38086952-38086974 GGGGTTTGGGGAGAAGGAGAGGG + Intronic
929078067 2:38094980-38095002 TTGGCGTAGGAAGTAGGTGAGGG + Intronic
929081326 2:38125354-38125376 CTGGCTTGGGTAGAAGGGAATGG + Intergenic
929586452 2:43118264-43118286 GTGGCTTTGGAATTAGGTAATGG - Intergenic
929617684 2:43324941-43324963 GTGGCTTTCGAAGGAGGAGAAGG + Intronic
929810774 2:45187849-45187871 AGGGCTGGGGATGAAGGTGATGG - Intergenic
930172391 2:48265048-48265070 GTGGCTGGGGAAAAAGGACATGG - Intergenic
930879499 2:56255331-56255353 GTGGGTGGTGAAGAAGGAGAGGG + Intronic
931452281 2:62378342-62378364 CTGCCTTGTGAAGAAGGTGCCGG + Intergenic
931897925 2:66754012-66754034 CTGGGGTGGGAAGAGGGTGAGGG - Intergenic
933435571 2:82244976-82244998 GTGGGGTGGGAAGAGGGGGAAGG + Intergenic
933891002 2:86769819-86769841 GGGCCTGGGGAAGAAGGGGAGGG + Intronic
933947761 2:87301530-87301552 GTGCCAAGGGAAGGAGGTGAGGG + Intergenic
934061542 2:88298704-88298726 TTGGGGTGGGGAGAAGGTGAGGG + Intergenic
935425653 2:102916229-102916251 CTGCCTTGTGAAGAAGGTGCTGG - Intergenic
936048086 2:109202192-109202214 GTGGCTTGGGAAACAAGGGAGGG - Intronic
936332441 2:111560043-111560065 GTGCCAAGGGAAGGAGGTGAGGG - Intergenic
936568903 2:113599461-113599483 GTGACTCAGGAAGAAGGTGGGGG + Intergenic
937073185 2:119081121-119081143 GAGGTTTGGGAAGTGGGTGATGG - Intergenic
938103392 2:128513362-128513384 ATGGCTTGGGAGGAAGGCCATGG - Intergenic
939644045 2:144674832-144674854 GGGGGTTGGGGAGAGGGTGAAGG - Intergenic
939745542 2:145961618-145961640 CTGGCTTGGGAGAAGGGTGATGG + Intergenic
940127985 2:150348630-150348652 ATGGGATGGGAGGAAGGTGATGG + Intergenic
940547742 2:155110660-155110682 GTAGCTTTGGAACTAGGTGATGG - Intergenic
940830250 2:158457715-158457737 GGGGCGTGGGAAGACGGGGAGGG - Intronic
940834232 2:158502548-158502570 GGGGACCGGGAAGAAGGTGAGGG - Intronic
941905507 2:170714389-170714411 GTGGCCTGGGGAGAAGGGGGCGG + Exonic
942411607 2:175715115-175715137 GGGGTTTGGGGAGAAGGGGAGGG + Intergenic
942423913 2:175838902-175838924 GTAGCTGGGGAAGAAGTTTATGG + Intergenic
942978066 2:182043302-182043324 GAGGCTTGGCAGGAAGTTGAGGG - Intronic
943312280 2:186341112-186341134 TTGGGTGGGGAAGAAGGTGCAGG + Intergenic
944194789 2:197041133-197041155 GTGCCTTTGGAAGAAGGGAAAGG - Intronic
944544694 2:200787747-200787769 GCGGCGTAGGAAGAAGGTGAAGG - Intergenic
945217129 2:207445550-207445572 GTGGCATAGGAAGCAGGAGAGGG - Intergenic
945763405 2:213943245-213943267 GTGTCTTTGGAAGTAGGTAATGG + Intronic
945893216 2:215452822-215452844 GTGGCTCGGGAAGAGAGTGAAGG + Intergenic
946415185 2:219536664-219536686 GCGGCTGGGGAGGAAGGTGCCGG + Intronic
947081565 2:226403351-226403373 GTGGAATGGAAAGAAGGTGATGG + Intergenic
947818900 2:233057312-233057334 GAGGCTTGGAAAGCAGCTGAGGG - Intergenic
948870261 2:240794252-240794274 GTGGTTTTGGAAGAAAGTGCTGG - Intronic
949000568 2:241610586-241610608 GTGGCTGGGGAAGCAGGAGTGGG - Intronic
1168747605 20:257746-257768 GTGGCTTGGGGAGCTGGTGGTGG - Exonic
1168761654 20:353854-353876 GGGCCTTGGGAAGAGGGTGTGGG - Exonic
1169051446 20:2582014-2582036 TTGGCTTGGGAAGAAGGAGAAGG + Intronic
1169130577 20:3164642-3164664 GTGGCTGGAGGAGAAGGAGAAGG - Exonic
1169260127 20:4131794-4131816 GAAGATTGGGAGGAAGGTGAAGG + Intronic
1169265702 20:4166206-4166228 GAGGCTTGGGATGAAGCTGCAGG + Intronic
1169329716 20:4706682-4706704 GGGCCCTGGGAAGAAGGTGAGGG - Intergenic
1169568484 20:6881605-6881627 GTGGCCTGAGGAGAAGGAGATGG - Intergenic
1169577945 20:6986775-6986797 GGAGGTTGGGAAGAGGGTGAGGG + Intergenic
1169987382 20:11460617-11460639 CTGGCTTGAGAAGGAGGAGATGG - Intergenic
1170591782 20:17777041-17777063 GTGTCTTAGGAAGTAGGTGTTGG - Intergenic
1170638824 20:18133874-18133896 TTTGTTTGGGAAGAAGGTGGAGG - Intergenic
1173181720 20:40811299-40811321 GTTGCATGTGAAGAAGATGAAGG + Intergenic
1173286099 20:41672573-41672595 AAGGCTGGGGAAGAAGGAGAGGG - Intergenic
1173544168 20:43880000-43880022 GTGGCATGGGAAAAAGTTCAAGG - Intergenic
1173565470 20:44035390-44035412 TTAGCTGGTGAAGAAGGTGAGGG - Intronic
1174439134 20:50535065-50535087 AAGGCTTGGGAAGGAAGTGAAGG - Intronic
1175306899 20:57982451-57982473 GGGGCCTGGGAAGAAGCTGCTGG + Intergenic
1175491671 20:59384356-59384378 GTGGCGGGGGAAGGAGGTGATGG + Intergenic
1175810857 20:61856619-61856641 GGGGCTGGGGAAGAATGTGGGGG - Intronic
1175910297 20:62402099-62402121 CTGACTTGGGAAGAAGGGGTTGG + Intronic
1178033159 21:28551419-28551441 CTGCCTTGTGAAGAAGGTGCCGG + Intergenic
1178509715 21:33194160-33194182 GAGCCTAGGGAACAAGGTGAGGG + Intergenic
1178578845 21:33819308-33819330 GTCGTTTCGGGAGAAGGTGAGGG + Exonic
1179633272 21:42691736-42691758 GTGACTTCGGATGATGGTGAAGG - Intronic
1179874096 21:44258827-44258849 GTGGACTGGGAAGAGGGAGACGG + Intronic
1179971544 21:44838670-44838692 CAGGCTTGGGAAGGGGGTGAAGG - Intergenic
1179997433 21:44980472-44980494 GGGGCCTGAGAAGAAGGGGAGGG - Intergenic
1180821017 22:18827762-18827784 GGGCCTTGGGAAGAAGGATAAGG - Intergenic
1180840714 22:18957662-18957684 GGGGCTTGGGAAGGTGGGGATGG + Intergenic
1181060773 22:20281112-20281134 GGGGCTTGGGAAGGTGGGGACGG - Intronic
1181119833 22:20658303-20658325 GAGGATTGGGAAAAAGATGATGG + Intergenic
1181191960 22:21148283-21148305 GGGCCTTGGGAAGAAGGATAAGG + Intergenic
1181207237 22:21262227-21262249 GGGCCTTGGGAAGAAGGATAAGG - Intergenic
1181495796 22:23286778-23286800 TTGGATTAGGAAGAGGGTGAGGG + Intronic
1182092575 22:27605889-27605911 GTGGGTTGGGGTGAAGGTCAGGG - Intergenic
1183004850 22:34892542-34892564 GGGGCATGGGAAGAGGCTGAAGG + Intergenic
1183159941 22:36106116-36106138 GTGGCATGGGAAAGAGCTGAGGG - Intergenic
1183195217 22:36349038-36349060 GGAGAATGGGAAGAAGGTGAAGG - Exonic
1183363231 22:37393803-37393825 AGAGCTTGGGAAGAAGGTGCTGG - Intronic
1183381139 22:37491123-37491145 CTGGCTTGGGGAGAAGGTGCAGG + Exonic
1184217456 22:43077189-43077211 GTACCTGGGGAAGCAGGTGAGGG - Intronic
1184676464 22:46045734-46045756 GTTCCTTGGGGAGCAGGTGAGGG + Intergenic
1184867358 22:47209192-47209214 GTGGCTTGGGGAGCAGGACATGG + Intergenic
1184960885 22:47927674-47927696 GTGGGATGGGAAGGAGTTGACGG + Intergenic
1185178430 22:49345317-49345339 GTGTCTTGGGAACAAGGCAATGG - Intergenic
1203219683 22_KI270731v1_random:33189-33211 GGGCCTTGGGAAGAAGGATAAGG + Intergenic
1203271144 22_KI270734v1_random:53638-53660 GGGCCTTGGGAAGAAGGATAAGG - Intergenic
949770498 3:7572047-7572069 GTGTCATGGGAGGAACGTGATGG - Intronic
949803119 3:7925149-7925171 GTGGCTTGGGAAGATGAAGCAGG + Intergenic
949882809 3:8675039-8675061 GTGGCTTGGGAACAAGCAGGAGG - Intronic
950406673 3:12809227-12809249 GTGTGTGGGGAGGAAGGTGATGG + Intronic
950873086 3:16245990-16246012 GTGGGATGGGAAGAAGGTTTGGG + Intergenic
951487907 3:23234646-23234668 GAGGCTTGGGAAGGAGGTAGGGG + Intronic
951616401 3:24550710-24550732 GTGCTTTTGGAAGAGGGTGAAGG - Intergenic
951786168 3:26421631-26421653 GGTGCTTGGGAAGAAACTGAAGG + Intergenic
952277141 3:31887916-31887938 GTGGTTTGGGAGGATGGTGATGG - Intronic
953397628 3:42585619-42585641 GTATATTGGGAAGAATGTGATGG - Intronic
954401875 3:50323302-50323324 GTGGGTTGGGGAGGAGGGGATGG + Intronic
954631269 3:52048873-52048895 GGGGCCTGGGAAGGAGGGGAAGG - Intergenic
959509178 3:107190340-107190362 GTGGCTTTGGAAGTGGGTAATGG - Intergenic
959809276 3:110595766-110595788 GTGGCTTTGGAAGCAGGTAATGG - Intergenic
960473054 3:118092100-118092122 GTGTCATGGGAAGAACCTGATGG + Intergenic
960829733 3:121834202-121834224 GTGCCTAAGGCAGAAGGTGAGGG + Intronic
961079884 3:124017197-124017219 GTTGCTTGGGACTAAGGTGGGGG + Intergenic
961272012 3:125696528-125696550 GTGGCTTGGGAACAAGCAGGAGG - Intergenic
961934185 3:130565692-130565714 TTGGCTTGGGAAGATGTGGATGG + Intronic
962032643 3:131617601-131617623 GTGGCATGGGAAGAAAGTGAGGG - Intronic
962310462 3:134323342-134323364 GCGGCAGGGAAAGAAGGTGATGG + Intergenic
963939966 3:151087446-151087468 CTGGCCAGGGACGAAGGTGAGGG + Intronic
964238612 3:154564482-154564504 ATGGCTTTGGAAGAATGAGATGG + Intergenic
965408622 3:168302019-168302041 ATAGGTAGGGAAGAAGGTGAAGG + Intergenic
965681689 3:171258468-171258490 GGGGCATTGGAAAAAGGTGAGGG - Intronic
966027402 3:175301266-175301288 GGGGTTTGGGAACAAGGGGAGGG - Intronic
966926887 3:184650277-184650299 ATGGCTTGGGATGATCGTGACGG + Intronic
966941871 3:184753013-184753035 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966941887 3:184753087-184753109 GTGGTAGGAGAAGAAGGTGATGG + Intergenic
966941900 3:184753145-184753167 GTGGTAGGAGAAGAAGGTGATGG + Intergenic
966941956 3:184753377-184753399 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966941971 3:184753432-184753454 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942001 3:184753542-184753564 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942022 3:184753632-184753654 GTGGTAGGAGAAGAAGGTGATGG + Intergenic
966942048 3:184753740-184753762 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942080 3:184753866-184753888 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942110 3:184753976-184753998 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942161 3:184754170-184754192 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942216 3:184754386-184754408 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
967410013 3:189157762-189157784 GTGGCTTAGGAAGGAGGACAGGG - Intronic
967521370 3:190436567-190436589 GTGGCTACAGAAGGAGGTGAGGG - Intronic
967709451 3:192688099-192688121 GGGGCTGGGGCAGAAAGTGATGG - Intronic
967910421 3:194538104-194538126 GTGGCTTAGAAAGACAGTGACGG + Intergenic
968544934 4:1193773-1193795 GTGGCGTGGGAAGGACGTGGGGG + Intronic
968544944 4:1193797-1193819 GTGGCGTGGGAAGGACGTGGGGG + Intronic
968544954 4:1193821-1193843 GTGGCGTGGGAAGGACGTGGGGG + Intronic
969322449 4:6420907-6420929 GAGGCTTGGTAAGCAGATGATGG - Intronic
969365884 4:6694102-6694124 GGGGCTGGGGAAGAAGGGGAAGG + Intronic
969477790 4:7431259-7431281 GTGGGTAGGGAAGAGGGTGTGGG + Intronic
969588440 4:8107883-8107905 GTGACTGTGGAAGAAGGTCAGGG + Intronic
970136475 4:12930313-12930335 GTAGCTTGGGAACTAGGTAAAGG - Intergenic
970698627 4:18708938-18708960 GTGGCTTTGGAACTGGGTGATGG - Intergenic
970877208 4:20885095-20885117 TTAGCTTGGGAAGCAGGGGAGGG - Intronic
970979402 4:22079053-22079075 GTGGGGTGGGGAGAAGGGGAGGG - Intergenic
973094360 4:46178605-46178627 GTGTCATGGGAAGAACCTGATGG + Intergenic
973337031 4:48967148-48967170 GTGGTTTGGGAATAAGTTGCTGG + Intergenic
975545326 4:75555002-75555024 GGAGGTTGGGAAGGAGGTGAGGG + Intergenic
975975191 4:80087670-80087692 GTGTCTTTTGAAGAAGATGATGG - Intronic
977204296 4:94152683-94152705 GTGGGTTGTGAGGGAGGTGAAGG - Intergenic
978755082 4:112293080-112293102 TTGGCTTGGCAAGTAGGTCAAGG - Intronic
979366979 4:119837185-119837207 GTAGCTGGAGAAGGAGGTGAAGG - Intergenic
979414929 4:120425499-120425521 GTGGCATGAGAAGATGATGAAGG - Intergenic
979841708 4:125450215-125450237 GTTGCTTGGGAAGAAAGTGGAGG - Exonic
982311295 4:153988069-153988091 GAGGCATGTGAAGAGGGTGAAGG - Intergenic
983100602 4:163621806-163621828 GTGGTTTGGGCAGAGGGTGTGGG + Intronic
985170019 4:187138849-187138871 GTGGCTTGGGAAAGAGGCCAGGG - Intergenic
985450779 4:190060933-190060955 ATGGCTTAGGAAGCAGGGGATGG + Intergenic
985830945 5:2229418-2229440 GTGGATTGGGGAGCAGGTGATGG - Intergenic
986152757 5:5142356-5142378 CTGGCTTGGTAAGAACCTGAAGG + Intronic
986762038 5:10889131-10889153 GTGTCATGGGAAGAAGCTGGTGG - Intergenic
986770277 5:10966549-10966571 GTAGCTCCGGAAGCAGGTGAGGG - Intergenic
987037952 5:14036812-14036834 GTGGCGTGAGAAGAAGGACATGG + Intergenic
987250189 5:16092583-16092605 GTGGGTGGGGAAAAAGGGGAGGG + Intronic
989099149 5:37808506-37808528 TTGGCTTGGGAAGGTGGAGATGG - Intergenic
989103961 5:37843513-37843535 GTGTCTTGGGAACAAGGGGATGG + Intergenic
989400117 5:40999714-40999736 GGTGCTGGTGAAGAAGGTGAAGG + Exonic
991143975 5:63279514-63279536 GTGGTTAGGGAAGGAGGGGAAGG - Intergenic
992267348 5:75032298-75032320 GAGGCTTGGGCAAGAGGTGAAGG - Intergenic
992629435 5:78666293-78666315 GTGCCTTGGGAATTAGGAGACGG + Intronic
994133803 5:96262283-96262305 GTGGGTTGGGAGGGAGGAGAAGG + Intergenic
994422011 5:99534256-99534278 GTGGCTGGTGCAGAAGGTGTTGG - Intergenic
994460832 5:100066328-100066350 GTGGCTGGTGCAGAAGGTGTTGG + Intergenic
994484979 5:100379753-100379775 GTGGCTGGGGCAGAAGGTGTTGG + Intergenic
995618365 5:113993894-113993916 GGGGGTTGGGAGGAAGGGGAGGG - Intergenic
995634600 5:114172153-114172175 GTAGGTTGGGATGAAAGTGAGGG - Intergenic
996642403 5:125771997-125772019 GTTGAGTGGGTAGAAGGTGAGGG + Intergenic
997975899 5:138441102-138441124 GTGGGTTGGGTAGGGGGTGAAGG - Intronic
999000056 5:147910802-147910824 CTAGCTTGGGAAGAAGGTATAGG + Intergenic
999191397 5:149750144-149750166 GTGGGTTTGGAAGGAGGAGAAGG + Intronic
999251159 5:150183236-150183258 GTGGCCTGGGAAGATGGAGAGGG + Intronic
999318407 5:150598880-150598902 CTGGCTTGGGAAGGAGGGGGAGG + Intergenic
999423618 5:151466866-151466888 GGGCATTGGGAAGAAGGTGAGGG - Intronic
999841893 5:155436725-155436747 GTGGCTTTGGAATAGGGTAATGG + Intergenic
1000027194 5:157369557-157369579 CTGGCTTTGGATGAAGGTGATGG - Intronic
1000157737 5:158568396-158568418 GTGACTTGGAGACAAGGTGAAGG - Intergenic
1000217764 5:159180092-159180114 GTGGGTAGGGAAGAAGGAGAGGG + Intronic
1000752477 5:165113945-165113967 GAGGATGGGGAAGAAGGGGAGGG - Intergenic
1001781253 5:174370963-174370985 GTGGGTTTGGAGGAAGGAGATGG - Intergenic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1002808576 6:603171-603193 GTGGGTGGGGTAGCAGGTGAGGG - Intronic
1003070716 6:2943542-2943564 GTGGCTTTGCTAAAAGGTGATGG - Intergenic
1003093521 6:3124043-3124065 GGGGTGTGGGAAGAAGGTAAAGG + Intronic
1004691043 6:17992419-17992441 TTGGCATGGGAAGCAGGAGAAGG - Intergenic
1005068081 6:21838183-21838205 GTGGTTTGGCAAGCAGGTGAGGG + Intergenic
1005467908 6:26133066-26133088 GTGGCTTTGGAAATTGGTGATGG - Intronic
1007091617 6:39188285-39188307 GTGGACTGGAAAGAATGTGAAGG - Intergenic
1007232374 6:40357302-40357324 GTGGCCTGGGAAGAACAAGAAGG - Intergenic
1007346907 6:41237585-41237607 GTGGGACGGGAGGAAGGTGAGGG - Exonic
1007614760 6:43173297-43173319 TTGTCTTGGGAAGAAGGTTATGG - Intronic
1007741484 6:44012562-44012584 GTGACTTGGGCAGATGGAGAGGG - Intergenic
1007836131 6:44675046-44675068 ATGGCTTGCGAAGCAGGTTAGGG + Intergenic
1008247976 6:49202759-49202781 CTGACTTGAGGAGAAGGTGAGGG + Intergenic
1008338282 6:50333272-50333294 GTCATTTGTGAAGAAGGTGACGG - Intergenic
1009202055 6:60758253-60758275 GTGGAATGGGAAGAAGGAGGTGG + Intergenic
1010205331 6:73317503-73317525 GTGGCTTGGGGAAAAGGGGAAGG + Intergenic
1010918875 6:81655836-81655858 GTGGCTTCGTAAGAAGTTGTGGG - Intronic
1011571966 6:88747305-88747327 GTGGTTTGGGAAAAAGGTTGAGG - Intronic
1011710590 6:90048824-90048846 CTTGCCTGGGAAGAAGCTGAAGG + Intronic
1012025969 6:93991707-93991729 GAGTCTGGGGAAGATGGTGAGGG + Intergenic
1012701420 6:102461473-102461495 GGGGCTGGGGAACAAGGGGAGGG + Intergenic
1014472336 6:121831997-121832019 GTGTCTTGGGAGGGACGTGATGG - Intergenic
1015478482 6:133680399-133680421 GTGGGTTTGGAAAAAGATGAAGG + Intergenic
1016234128 6:141841604-141841626 CTGCCTTGTGAAGAAGGTGCTGG + Intergenic
1016988951 6:149916362-149916384 GAGGCTGAGGAAGAAGGGGAAGG - Intergenic
1017083699 6:150693680-150693702 CTGGCTCTGGAAGGAGGTGATGG - Intronic
1017391878 6:153948850-153948872 GAAGGTTGGGAGGAAGGTGAAGG + Intergenic
1017491605 6:154950451-154950473 GTGTCTTTGGAAGAGGGAGAGGG - Intronic
1017809050 6:157970909-157970931 GGGACTTTGGAAGAAGATGATGG + Intergenic
1018214583 6:161514594-161514616 CTGGCTTAGGAGGGAGGTGATGG + Intronic
1019903398 7:4042235-4042257 GTGGATGGGGAAGAAGGAGGTGG - Intronic
1020261870 7:6535405-6535427 AAGGCTTGGGGAGAAGGAGAAGG - Intronic
1020560814 7:9727461-9727483 GTGGCTGGAGACCAAGGTGATGG + Intergenic
1020900142 7:13993416-13993438 GGAGCCTGGGAAGAAGGTAAGGG + Intergenic
1021852817 7:24825083-24825105 GTGACTTGGGAAGTTGGTGGAGG + Intronic
1022544739 7:31175471-31175493 GGAGGTTGGGAAGCAGGTGATGG - Intergenic
1023477148 7:40593104-40593126 ATGGCCAGGTAAGAAGGTGAAGG + Intronic
1023520989 7:41049806-41049828 GTGGCCAGGGAAGTTGGTGAGGG + Intergenic
1024535524 7:50428010-50428032 GTGGCTTTGGAAGCAGGCCATGG - Intergenic
1024762187 7:52612148-52612170 GTGGCTTTGGAACTGGGTGATGG - Intergenic
1024975363 7:55109277-55109299 GATGCTTGGGAAGAAGATGAGGG - Intronic
1025110333 7:56211296-56211318 GAGGCTGGGGCAGAAAGTGACGG + Intergenic
1025968259 7:66296129-66296151 GTGGGTTGGGAAGAATGCTATGG + Intronic
1026425008 7:70282235-70282257 GTGGCTTTGGAACTGGGTGATGG - Intronic
1026904807 7:74056838-74056860 GTGGCTTTGGAAGATGGGGCAGG - Intronic
1027479581 7:78678928-78678950 GTGACTTGGTGAGAAGGAGAGGG - Intronic
1028460726 7:91089220-91089242 GAGGCTGGGGAAGAAAGAGAAGG - Intronic
1028668981 7:93379140-93379162 GTGGCTCTGGAAGAATGTGAGGG + Intergenic
1028674722 7:93445415-93445437 GTCACTTGGGGAGAAGGAGATGG + Intronic
1028857082 7:95604805-95604827 GTGGGTTGGGAGGAGGGGGAAGG - Intergenic
1029061226 7:97799984-97800006 GAGGCTTGGGAAGAGAATGATGG - Intergenic
1029861810 7:103580718-103580740 GAAGTTTGGGAGGAAGGTGAGGG - Intronic
1032435577 7:131897733-131897755 TTTGCTTAGGAGGAAGGTGATGG + Intergenic
1032532160 7:132630957-132630979 GTGTCATGGGAAGAAGTTGAAGG - Intronic
1035373523 7:158393861-158393883 TTGGCTGGGGAGGGAGGTGATGG - Intronic
1035888884 8:3323385-3323407 GTGACTTGGGAAAATGGGGAAGG - Intronic
1036021569 8:4852630-4852652 GTGGCTTTGGAACTAGGTAATGG + Intronic
1036239596 8:7070816-7070838 GTGGCTTGGGAACATGCAGAAGG - Intergenic
1036609238 8:10335161-10335183 ATGGAATGGGAAGCAGGTGAAGG + Intronic
1036991830 8:13607073-13607095 GTGGGTGGGGAACAAGGGGAGGG - Intergenic
1037009256 8:13820254-13820276 GTGGCTTCGGAACTAGGTAATGG - Intergenic
1037621496 8:20567206-20567228 GTGGGTGGGGAAGACAGTGAAGG - Intergenic
1037628129 8:20626455-20626477 CTGGCTTGGGATTAAGGAGATGG + Intergenic
1039367720 8:36948792-36948814 GTGGCTGGGGTAGAGGGTAAAGG + Intergenic
1039378920 8:37066813-37066835 AGGGCTTGGGAAGAAGAGGATGG + Intergenic
1040786948 8:51177218-51177240 TGAGGTTGGGAAGAAGGTGAGGG + Intergenic
1041044249 8:53876978-53877000 GTGACTTGGGAAGAAGGACTGGG + Intronic
1041461482 8:58116393-58116415 CTGGCATGGGAGGAAGGAGATGG - Intronic
1041703118 8:60814169-60814191 GAGGCTTAGGAAGAAGAGGAAGG - Intronic
1042511088 8:69611988-69612010 GAAGGTTGGGAAGCAGGTGAGGG - Intronic
1043774245 8:84244835-84244857 GGGACTTGTGAAGATGGTGAAGG + Intronic
1043941106 8:86196852-86196874 GTGGCTGGGGAAGGAGAAGATGG + Intergenic
1046368313 8:113267594-113267616 GTGAATGGGGAAGAAGGGGAGGG + Intronic
1046566721 8:115911376-115911398 GTTGATTGGGAAGAAAGGGAAGG - Intergenic
1047872268 8:129097280-129097302 GTGGTTTGAGAACAGGGTGATGG + Intergenic
1048387924 8:133930564-133930586 GTGGCTAGGGGAGAAGCTAAGGG + Intergenic
1048512892 8:135078530-135078552 GGAGATTGGGAAGAAGGGGAGGG - Intergenic
1048651598 8:136484477-136484499 GGGGCTGGGAAAGAACGTGAAGG - Intergenic
1049883629 9:14071-14093 GTGACTCAGGAAGAAGGTGGGGG - Intergenic
1050124978 9:2347498-2347520 GTGGCTTTGGAATAAGGGAAAGG - Intergenic
1052123320 9:24744801-24744823 GGGGCTGGGGAACAAGGAGAAGG + Intergenic
1052153582 9:25152691-25152713 GGGGTTTGGGAGGAAGGGGAGGG - Intergenic
1052864765 9:33458231-33458253 AAGGCTTGGGAAGAAGGAGAAGG + Intergenic
1055146112 9:72936898-72936920 GTTGGTTGGGAAGGAGGTGAGGG - Intronic
1055373781 9:75626810-75626832 TAAGCTTGAGAAGAAGGTGAGGG + Intergenic
1055980497 9:81995508-81995530 GTGAATGGGGAGGAAGGTGAAGG - Intergenic
1056020800 9:82436597-82436619 GGGGCTGGGGGAGAAGGTGGCGG + Intergenic
1056760993 9:89414892-89414914 GGGGTTTGGGAAGTGGGTGAGGG - Intronic
1057191177 9:93088462-93088484 TTGCCTTGGGAGCAAGGTGAAGG - Intergenic
1057539726 9:95955502-95955524 GTTGCTTGGGGATAAGGGGATGG - Intronic
1057603139 9:96476775-96476797 GTGGGTAGGGAATAAGGTTAAGG + Intronic
1057813758 9:98278944-98278966 GTGGCTTGGCAAGGAGATGTGGG - Intergenic
1058131509 9:101259202-101259224 GTGGCCAAGTAAGAAGGTGAAGG + Intronic
1058758046 9:108102067-108102089 GAGGGTTGGGAAGAAGGGAAGGG + Intergenic
1058758345 9:108104639-108104661 GAGGCTGGGGAAGTAGGTGCAGG + Intergenic
1059816107 9:117917514-117917536 GTATCTTGGGAAGGAGGTGATGG + Intergenic
1060220477 9:121761693-121761715 AAGGCTGGGGGAGAAGGTGAGGG - Intronic
1061052966 9:128206883-128206905 GTGACTTGGGGAGCGGGTGAGGG + Intronic
1061393970 9:130333252-130333274 GTGGCATGGGAAGCATGTAATGG + Intronic
1061568160 9:131458066-131458088 GTGGCTGGACAAGAAGGGGATGG - Intronic
1061928879 9:133822048-133822070 GGGTCTCGGGCAGAAGGTGAAGG - Intronic
1062697220 9:137881560-137881582 CTGCCTTAGGAAGCAGGTGAAGG - Intronic
1185727435 X:2433545-2433567 GGGGCTGGGGAACAAGGAGAGGG - Intronic
1187005964 X:15232557-15232579 GTTGGTTGGGAAGAAGCTGCTGG + Intergenic
1188995644 X:36881851-36881873 GGGGATTTAGAAGAAGGTGAGGG + Intergenic
1189715966 X:43866549-43866571 GGGGCTGGGGAAGAAGGGAATGG + Intronic
1190035326 X:47018210-47018232 GAGGTGTGGGAAGAAGGAGATGG - Intronic
1190212946 X:48461841-48461863 GGGGGATGGGAAGAAGGGGATGG - Intronic
1191791784 X:64978833-64978855 CTGGCTTGGGGAGAAGCGGAGGG + Intronic
1191808980 X:65166186-65166208 GTGGGGTGGGAAGAGGGGGAGGG - Intergenic
1191817325 X:65260421-65260443 GTAGGGTGGGAAGAAGGTTAAGG + Intergenic
1193294722 X:79820919-79820941 GTGGCATGGCAAGAAGGTGTAGG + Intergenic
1194978654 X:100417636-100417658 GTGGGGTGGGAAGGAGGTTATGG + Intergenic
1195128362 X:101830955-101830977 CTGGCTAGGGAAGAAGGTCCAGG + Intergenic
1195139593 X:101945903-101945925 GTGGCTTTGGAACTAGGTAATGG + Intergenic
1195652431 X:107299324-107299346 GAGGGTTGGGGAAAAGGTGAGGG + Intergenic
1196020267 X:110984031-110984053 GTGGTTTGGGAAAGAGATGATGG - Intronic
1196031786 X:111100213-111100235 AAGTCTTGGGATGAAGGTGAAGG + Intronic
1196049857 X:111293225-111293247 TGGGCTTGGGAAGAGGTTGATGG - Intergenic
1196747808 X:119087220-119087242 GAGGCTTGGGAAGAATGTTTGGG + Exonic
1196931210 X:120683772-120683794 TTGGCATGGGGAGAAAGTGAGGG + Intergenic
1197636503 X:128920662-128920684 GTGGGTTGGGGACAGGGTGATGG + Intergenic
1197726271 X:129778791-129778813 TTGGTTTGGGGAGAAGGGGAGGG - Intergenic
1198155408 X:133955167-133955189 GTGGCTTAGGAACAATGTGGTGG - Intronic
1199310669 X:146316310-146316332 GTGGCTTGAGGAGATTGTGATGG - Intergenic
1200402189 X:156026078-156026100 GTGACTCAGGAAGAAGGTGGGGG + Intergenic
1200494572 Y:3865743-3865765 GGAGCTTGGGAAGAGGATGATGG + Intergenic
1201389112 Y:13478509-13478531 GAAGCTTGGGAAGAGGGTGGAGG - Intronic