ID: 917633050

View in Genome Browser
Species Human (GRCh38)
Location 1:176908669-176908691
Sequence CTGTTATTCTGAAGGTTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917633048_917633050 18 Left 917633048 1:176908628-176908650 CCATATCTGTAGAATGGGTTAAT 0: 1
1: 4
2: 32
3: 212
4: 1035
Right 917633050 1:176908669-176908691 CTGTTATTCTGAAGGTTAAATGG 0: 1
1: 0
2: 2
3: 20
4: 238
917633045_917633050 28 Left 917633045 1:176908618-176908640 CCTTCAGTTGCCATATCTGTAGA 0: 1
1: 0
2: 6
3: 49
4: 357
Right 917633050 1:176908669-176908691 CTGTTATTCTGAAGGTTAAATGG 0: 1
1: 0
2: 2
3: 20
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917633050 Original CRISPR CTGTTATTCTGAAGGTTAAA TGG Intronic
906418076 1:45638294-45638316 CTTTTACTGTCAAGGTTAAAAGG + Intronic
907851557 1:58259937-58259959 GGGTTATTGTGAAGGTTAAATGG - Intronic
908276454 1:62477442-62477464 CAGTAATTCTGAAGGATACAGGG + Intronic
908708432 1:66988197-66988219 CTGTTCTTCTGTATGTTACATGG - Intronic
911542576 1:99175854-99175876 ATGTTATTTTGAGGATTAAATGG - Intergenic
912128754 1:106574361-106574383 CTGTTATTTTGAAAATTAAAGGG - Intergenic
912724395 1:112045678-112045700 GGGTTATTATGAAGATTAAATGG + Intergenic
916231022 1:162541489-162541511 CTGTTATTATAAAGGTTCACAGG + Intergenic
917633050 1:176908669-176908691 CTGTTATTCTGAAGGTTAAATGG + Intronic
917855537 1:179096264-179096286 CAGTCATTCTGAGGATTAAATGG + Intronic
918134000 1:181654122-181654144 CTGTTATTCTGTAAATGAAATGG - Intronic
918604392 1:186404266-186404288 CTGTTGGTCTGAGGTTTAAATGG - Intronic
918661024 1:187089194-187089216 CTATTATTTTAAAAGTTAAAGGG - Intergenic
920009591 1:202858306-202858328 CTGTTATTTTAGATGTTAAATGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
923363968 1:233241132-233241154 CTGTTATTTTGAATTTTAACAGG + Intronic
923397342 1:233580087-233580109 CTGTTATTATCAAGTTTATAAGG + Intergenic
1062881919 10:986122-986144 CTGTAATTCTGATGGATGAAAGG - Intergenic
1064825679 10:19396479-19396501 ATCTTATTTTGAAGATTAAATGG - Intronic
1065051580 10:21798106-21798128 CAGTTCTTCTGAAGGTTACAAGG + Intronic
1074132869 10:110597916-110597938 ATGTTATTCTGAGAGTGAAATGG + Intronic
1074611440 10:115025845-115025867 GGGTTGTTCTGAAGGTCAAAGGG - Intergenic
1074903745 10:117841955-117841977 CTGTTATATTGAAGGGTAAAGGG - Intergenic
1076623068 10:131805209-131805231 TTGTTATTATTAAGGATAAAGGG + Intergenic
1082003170 11:47405241-47405263 ATGTTGTTGTGAAGATTAAATGG - Intergenic
1086668918 11:89522832-89522854 CAGTTATTCAGAAGGCAAAAGGG + Intergenic
1088424741 11:109691160-109691182 GGGTTCTTCTGAAGATTAAATGG + Intergenic
1088898724 11:114098280-114098302 CTGTGCTTTTGAAGGTTTAATGG + Intronic
1089464112 11:118672985-118673007 CTGCTTTTCTGGAAGTTAAAGGG - Intronic
1091310532 11:134572393-134572415 CTGTTTTTCTAACTGTTAAATGG + Intergenic
1091827273 12:3522267-3522289 CTGTCATTCCTTAGGTTAAAAGG + Intronic
1091929190 12:4381206-4381228 GAGTTATTCTGAAGATGAAATGG - Intergenic
1093828776 12:23729181-23729203 CTGGTTCTCTGAAGATTAAATGG - Intronic
1094104978 12:26801322-26801344 CTCCCATGCTGAAGGTTAAATGG - Intronic
1095241806 12:39869269-39869291 TTCTTATTCTGAAGGTGTAAAGG + Intronic
1096283471 12:50277281-50277303 CTATTTTCCTGAAAGTTAAAGGG + Intronic
1096442170 12:51652481-51652503 CTTTTATTCTGAAGGCAATAAGG - Intronic
1098351881 12:69571450-69571472 CTGTTATTCAAAATGTGAAAGGG - Intronic
1099641460 12:85291758-85291780 CTGTTATTGTGAAGACTAAATGG + Intronic
1100479205 12:94961568-94961590 CTGTAATTCTAAAGGGTGAATGG + Intronic
1102542396 12:113631539-113631561 CTTTAAAACTGAAGGTTAAAAGG + Intergenic
1106726460 13:32491133-32491155 CTGAGATTCTGAAGGGAAAAGGG + Intronic
1108502481 13:51080856-51080878 CTTTTATAATGAAGCTTAAAAGG + Intergenic
1109004182 13:56848521-56848543 GTATTATTCTGACGCTTAAATGG - Intergenic
1109309993 13:60682122-60682144 TTGTTATTGTGAGGATTAAAGGG + Intergenic
1111229486 13:85325075-85325097 ATGTTCTTTTGAAGGTTGAATGG - Intergenic
1111291837 13:86181889-86181911 ATGTCATTCAGAAGGTTCAAGGG - Intergenic
1112494113 13:99892429-99892451 CTCTTATATTGAAGGCTAAAGGG + Exonic
1117772139 14:59144412-59144434 AAGTTATTGTGAAGATTAAATGG - Intergenic
1117871412 14:60204974-60204996 ATGTTATTCTGGAGGCTGAAAGG + Intergenic
1118990056 14:70789863-70789885 CTGTTATTCTGCAGGTCAGTGGG + Intronic
1119284303 14:73439469-73439491 TTGTTATTTTGAAAATTAAAAGG + Intronic
1119634590 14:76263722-76263744 CAGTTGTTGTGAAGGTTAAATGG - Intergenic
1120541307 14:85754141-85754163 CTGTTATACTGAAAGTTGACCGG - Intergenic
1120636284 14:86955305-86955327 CTATTAATCAGGAGGTTAAAAGG + Intergenic
1120844427 14:89113542-89113564 GTGTTGGTGTGAAGGTTAAATGG - Intergenic
1123166336 14:106328749-106328771 CTGTTATTCAGCAGCTTAACTGG - Intergenic
1123169018 14:106353782-106353804 CTGTTATTCAGCAGCTTAACTGG - Intergenic
1123772148 15:23539498-23539520 CTGTAACTCTGAAGGGAAAAAGG - Intergenic
1123793854 15:23752361-23752383 CTGTTCCTTTGAGGGTTAAATGG + Intergenic
1124919523 15:34012458-34012480 CTGTTTTTCTGAAGGCGGAAAGG + Intronic
1125166021 15:36705650-36705672 TTGTGAATCTGAAGGTTAACAGG + Intronic
1126208458 15:46072966-46072988 TTGTTATTCTCAAGGTAGAAAGG + Intergenic
1126730740 15:51680087-51680109 CTGTTATTATGAAGATCAAATGG - Intergenic
1127328746 15:57918950-57918972 TTGTTTTCCTGAAGGTTCAAGGG + Intergenic
1128366054 15:67004034-67004056 GAGTTGTTGTGAAGGTTAAATGG + Intergenic
1128676498 15:69613018-69613040 CAGTTCTTCTGAAGGGCAAAGGG - Intergenic
1129436583 15:75546264-75546286 CTGTTATTGAGAAGTTTGAAGGG - Intronic
1129460714 15:75698824-75698846 CTGTTACTCTGAGGGTAACAAGG + Intronic
1131312245 15:91301573-91301595 AGGTTATTATGAAGGTTAAAGGG - Intergenic
1132509775 16:333465-333487 CTTTAATTCTGGAGTTTAAATGG - Intronic
1134355038 16:13474452-13474474 CTGTAGTTTTGAAGATTAAACGG - Intergenic
1140777300 16:78261590-78261612 CTTTTTTTCCTAAGGTTAAAAGG - Intronic
1141075015 16:80997832-80997854 ATATTATTCTGAGGGTTAAAGGG + Intronic
1141555781 16:84835786-84835808 CCTTTGTTCTGAATGTTAAAGGG - Intronic
1145074622 17:19841941-19841963 CCACTATTCTGAAGGTTACACGG + Intronic
1146450627 17:32971264-32971286 CTGTTATCCCTTAGGTTAAAAGG + Intronic
1146511067 17:33449144-33449166 CTGTTATTCTCAACCTCAAAGGG - Intronic
1147712236 17:42477029-42477051 CTCATATTCTGAATTTTAAAGGG + Intronic
1149050643 17:52300533-52300555 CAGTTATTTTGTAGGTAAAATGG + Intergenic
1151366177 17:73617779-73617801 CTGTTTTTCTGGAGGTGAATTGG - Intronic
1151975997 17:77483795-77483817 CTGTTCTTCTCAGGGTTGAAAGG - Intronic
1153525181 18:5988183-5988205 CTGTGATGCTGCAGCTTAAATGG - Intronic
1153726585 18:7962922-7962944 CTGTTATTCGGAAGGCATAAAGG + Intronic
1155041844 18:22071352-22071374 CTGTCATTCTCCAGCTTAAAGGG + Intergenic
1156603831 18:38642270-38642292 CTAATAATCTGAACGTTAAAAGG - Intergenic
1156823075 18:41396050-41396072 CTGTTACTCTGAAACTAAAAAGG - Intergenic
1157103097 18:44747678-44747700 CAGTTATTCAGAATGTTAAGAGG + Intronic
1158484574 18:57854327-57854349 CTGTGAGTTTGAAGGCTAAATGG - Intergenic
1158898384 18:61937313-61937335 GGGTTATTCTGAGGATTAAAGGG - Intergenic
1159194885 18:65100640-65100662 CTGTTATTCTTTAGGTCACATGG - Intergenic
1159930153 18:74303556-74303578 GTGTTATTCTGAAAGTTCATTGG - Intergenic
1162148992 19:8631621-8631643 CTGTTCTTCTGAAAGTAAACAGG + Intergenic
1168452370 19:56476556-56476578 GTGTTATTGGGAAGATTAAATGG - Intronic
1168594896 19:57667454-57667476 CTGTTATTTTGATGTTAAAATGG + Intergenic
1168668607 19:58224016-58224038 CTTTTCTTCTGAATATTAAAGGG - Intergenic
926175853 2:10591555-10591577 CTGTTATTTTGAAGATATAAGGG + Intronic
927131872 2:20066945-20066967 CTCTTATTTTGAAAGTCAAAAGG - Intergenic
930576537 2:53157354-53157376 CTGTCATTGGGAAGGTAAAACGG - Intergenic
930589582 2:53311683-53311705 CTGTTAGTTTGAAAGTAAAAGGG - Intergenic
931194064 2:60033786-60033808 CTGTTATTCAGAAGATGATAAGG + Intergenic
931527861 2:63177604-63177626 CAATTATTCTAAAGTTTAAATGG + Intronic
932375739 2:71234294-71234316 CTGTTGTTTTGAAAATTAAATGG - Intergenic
932470685 2:71953275-71953297 CTGTTACTGTGAAGTTCAAAGGG + Intergenic
938681499 2:133696387-133696409 CTGTTTTTCTCAAGGAAAAAGGG + Intergenic
938713391 2:133995309-133995331 TTGTGATTTTGAAGATTAAACGG - Intergenic
940482933 2:154258359-154258381 CTGTTATTCAGAGGTTTGAAAGG - Intronic
941901983 2:170687578-170687600 CTGCTATTCTGAAAGTAAAATGG - Intergenic
942526031 2:176853873-176853895 CTATTATTCTAAAGGGCAAAAGG + Intergenic
942607156 2:177704640-177704662 TAGTTCTTCTGAATGTTAAATGG + Intronic
942798191 2:179845945-179845967 CTGTTCTTTTGAAAGATAAAGGG + Intronic
944140927 2:196455927-196455949 ATGTTATCCTTAAAGTTAAAGGG - Intronic
944183684 2:196925811-196925833 CTCTTATTTTGCAGGTTAAGGGG - Intronic
944848512 2:203692803-203692825 CTGTGATTCTGAAGATCTAATGG - Intergenic
946516374 2:220415926-220415948 TAGTTATTCTAAAGATTAAATGG + Intergenic
1169787414 20:9374888-9374910 CTGTAATTGTGAGGGATAAAAGG - Intronic
1171111436 20:22486425-22486447 CTTCTAGTGTGAAGGTTAAATGG - Intergenic
1171156112 20:22876176-22876198 CTGTTTTTCTCATGGTTAGATGG + Intergenic
1176665830 21:9686676-9686698 CTCTGTTTCTGAAGTTTAAAGGG - Intergenic
1177369429 21:20182163-20182185 CAGTTATTCTGAAGACTACAAGG - Intergenic
1177698952 21:24611895-24611917 CTCTTTTTCTGAAGATCAAAAGG - Intergenic
1177805389 21:25869955-25869977 CTGGTGTTCTGAAGGATGAATGG + Intergenic
1179027548 21:37692295-37692317 CTTTTTTTCTCAAGGGTAAAGGG - Intronic
1179178722 21:39027387-39027409 CTGTTATTTTGTTTGTTAAATGG + Intergenic
1179230719 21:39501594-39501616 CTGTCTTTCTGTAGGATAAATGG - Intronic
1179234354 21:39531725-39531747 CTGTTAGTGAGAATGTTAAATGG + Intergenic
1184184379 22:42855056-42855078 GGGTTATTGTGAAGATTAAATGG - Intronic
949111669 3:268928-268950 CAGTAATTATGAATGTTAAAGGG + Intronic
950256253 3:11509022-11509044 TTGTTATTTTAAAGTTTAAAGGG - Intronic
950358337 3:12430567-12430589 GGGTTATTGTGAAGATTAAATGG + Intronic
951645443 3:24885445-24885467 CTGTGGTTCTGAATATTAAATGG + Intergenic
951860864 3:27250977-27250999 CTGTTAGTCTAAAGTTTGAAAGG - Intronic
951932804 3:27987995-27988017 CCTTTATTCTAAAGGATAAAGGG + Intergenic
952209858 3:31219334-31219356 TTGTTTGTCTGAAGGATAAATGG + Intergenic
952563962 3:34633270-34633292 CTGTAATTCTAAAGTTTAGATGG - Intergenic
952961344 3:38591726-38591748 CGGTTATTGTGAGGGTTAAATGG - Intronic
953093777 3:39754958-39754980 CTGTTATTCTGAAGATTAAGTGG - Intergenic
953485597 3:43291598-43291620 CAGTTATTGTGAAAGTTAAATGG - Intronic
953498955 3:43414238-43414260 CTGTTTTTCTGAAAGGGAAAAGG - Intronic
953596424 3:44318627-44318649 CTGTTATTCTGAGGGTCCTAGGG + Intronic
955525087 3:59811872-59811894 CTGTGATTGTGAAGGTGACAAGG + Intronic
956670908 3:71688847-71688869 CAGATATTCTGAATTTTAAATGG - Intronic
957546476 3:81644586-81644608 CTTTTATTCTGAAGGAGACAGGG + Intronic
958456815 3:94342636-94342658 CTCTAACTCTCAAGGTTAAATGG + Intergenic
959887284 3:111517304-111517326 CTGTGAATCTGAAGGTTCAGGGG - Intronic
959947107 3:112136892-112136914 CTTTTTTTCTGAAGGTAATAGGG - Intergenic
960202212 3:114850486-114850508 AGGTTGTTATGAAGGTTAAATGG - Intronic
961051457 3:123750590-123750612 CTGTCTTTCTGCAGGATAAAGGG - Intronic
961813133 3:129533136-129533158 GTCTTATTCTGAGGGGTAAAGGG + Intronic
962140322 3:132783604-132783626 CTTTCATTCTGAAGGTACAATGG - Intergenic
962574698 3:136746076-136746098 CTGTTATTTTGGTGGTTAAGGGG - Intronic
963105327 3:141642212-141642234 CTGTTAGGCTGAAGGCAAAATGG + Intergenic
963219918 3:142797680-142797702 CCGTTATTGTGAGGATTAAATGG + Intronic
963463551 3:145648479-145648501 ATGTTACCCTGAATGTTAAAAGG + Intergenic
963722204 3:148874913-148874935 CTATTATTCTGAAGTTCAATGGG + Intronic
969784213 4:9440664-9440686 TTTTTATTCTGAAGCTTATAGGG + Intergenic
970690902 4:18619395-18619417 GAGTTATTTTGAAGATTAAATGG + Intergenic
971591030 4:28469630-28469652 CCTTTACTCTGAATGTTAAATGG + Intergenic
971613259 4:28753932-28753954 ATGTAATTCTCAAGGTTAAGAGG - Intergenic
975190887 4:71460727-71460749 CTGATATTCTGAAGGAGAAGGGG + Intronic
976331364 4:83834568-83834590 GTGTTATTTTGAATATTAAATGG + Intergenic
976928592 4:90533944-90533966 GTATTATTCTGAAGGGTAAATGG - Intronic
977683520 4:99821242-99821264 GTGTTATTGTGAAGCCTAAATGG - Intronic
978354168 4:107853008-107853030 CTTTTATTGTGAAGGTTTGAAGG + Intronic
978705561 4:111705383-111705405 CTGTGATTTGGAAGTTTAAAAGG - Intergenic
978730213 4:112017584-112017606 TTGTTATTTTGAAAGTCAAAGGG - Intergenic
979087836 4:116436331-116436353 CTTTTGTTCTGAAGGAGAAATGG + Intergenic
979974359 4:127178253-127178275 CTCTTATTCTGCAAATTAAAGGG + Intergenic
980613685 4:135191714-135191736 TTGGTATGCTGAAGCTTAAAAGG + Intergenic
981718983 4:147779847-147779869 CTCTTATTCTGAGGTTTAAATGG + Intronic
982540964 4:156670402-156670424 CTGTTATTTTGATGTTAAAATGG - Intergenic
983820161 4:172183224-172183246 CTTTTATTCCAAAGTTTAAAAGG + Intronic
983822266 4:172210529-172210551 CTGTTTTTCTGATGATTAGATGG + Intronic
983981635 4:174004865-174004887 CTCTTACTTTCAAGGTTAAAGGG - Intergenic
984126729 4:175819544-175819566 CTGTTGTGGTGAAGGTTAAATGG - Intronic
984328778 4:178288849-178288871 TTGTTATTATCAAAGTTAAATGG + Intergenic
984871682 4:184331054-184331076 GTGTTACTCAGAAGGTGAAATGG + Intergenic
985235589 4:187870264-187870286 CTTTTATTCTGAAGTTTAAATGG + Intergenic
985349709 4:189046090-189046112 CTGTTTTTCTATAAGTTAAAAGG + Intergenic
985411559 4:189690934-189690956 CTCTGTTTCTGAAGTTTAAAGGG - Intergenic
985421228 4:189786986-189787008 GATTTATTCTGAAGGTTCAATGG - Intergenic
988224860 5:28400065-28400087 GTGTTATTCAGAAGGTCCAAAGG - Intergenic
989187503 5:38639228-38639250 ATGTTAGTCTGAAGGCAAAATGG - Intergenic
990810779 5:59720453-59720475 CTCTTATTCTGTAGTTGAAATGG - Intronic
992270596 5:75059057-75059079 TTGTTATTATGAAGATTATATGG - Intergenic
992869511 5:80992132-80992154 GTGATATTCTGCATGTTAAAAGG - Intronic
993768657 5:91895099-91895121 CTGTTACCATGAAGTTTAAAAGG + Intergenic
993958645 5:94268725-94268747 GTGTTACTCTGATGGATAAATGG + Intronic
994087181 5:95772205-95772227 TTGGTAATCTGAAGGTTATATGG + Intronic
997533760 5:134599634-134599656 TTGTTAGTGGGAAGGTTAAAGGG + Intergenic
997585994 5:135043840-135043862 ATGTTATCCTGAAGGCAAAAAGG + Intronic
1000628456 5:163565730-163565752 CTTTTATCCTGATGGTTCAATGG + Intergenic
1000767095 5:165305655-165305677 GTGCTAGTCTGAAGGTTTAACGG - Intergenic
1001179975 5:169511339-169511361 CTGTTACTCTTAAGGTGAATGGG - Intergenic
1003272249 6:4617580-4617602 CTCTGATTCTGGAGGTCAAATGG - Intergenic
1004051682 6:12087147-12087169 CTGTTATTATCAAGATAAAAAGG + Intronic
1004530359 6:16448925-16448947 CTGTTGTTGTGAGGGTTAAAGGG + Intronic
1004963405 6:20819502-20819524 CTGTTTTTCTGATGATCAAATGG + Intronic
1004964495 6:20832906-20832928 CTTTTAGTCTGAGGATTAAATGG + Intronic
1005245544 6:23880373-23880395 GTGTTGTTTTGAAGATTAAATGG - Intergenic
1006050247 6:31336691-31336713 GGGATATTCTGGAGGTTAAAGGG - Intronic
1007519095 6:42437834-42437856 CAGTTGTTCTGAGGGTTAAAGGG + Intronic
1009761913 6:68018036-68018058 TTGATATTTTGAAGGTAAAAGGG + Intergenic
1010584745 6:77643801-77643823 GGGTTATGCTGAAGGATAAAGGG + Intergenic
1011617738 6:89212462-89212484 CGTTTATTCTGAAGGTGAAGAGG - Intronic
1011691546 6:89874755-89874777 CTGTGAGTCTGAAGGCTGAAGGG - Intergenic
1012023994 6:93965016-93965038 CTGCAATTCTGAAAGTTACATGG - Intergenic
1013168022 6:107611099-107611121 CTTTACTTCTGAAGGTCAAATGG + Intronic
1013467436 6:110430047-110430069 CTTTTATTCTGAAGCTGACAGGG + Intronic
1013942102 6:115677056-115677078 GGGTTATTATGAAGGTTAAACGG + Intergenic
1014193897 6:118529840-118529862 CTTTTAGTCTGAAGGTTTTAAGG - Intronic
1015696617 6:135987525-135987547 GTGTTATTCTGAAGGGAAGAAGG - Intronic
1015738636 6:136428850-136428872 ATGTTATTCTGGAGATTATAAGG - Intronic
1017888407 6:158619999-158620021 CTGAGAATCTGAAAGTTAAAGGG + Intronic
1018375925 6:163212574-163212596 CATTTATTTTGAAGGTCAAAGGG - Intronic
1018401508 6:163425407-163425429 ATTTTATTCTGAAGGTTGTAGGG + Intronic
1028270851 7:88787270-88787292 TTTTTATCCTGAAGGTGAAATGG + Intronic
1028437688 7:90823377-90823399 CAGTTATTTTGAAGATTCAATGG - Intronic
1028601616 7:92606905-92606927 GTTTTTATCTGAAGGTTAAAGGG - Exonic
1030371951 7:108710654-108710676 CTATGATTCTCAAGGTTAGAGGG - Intergenic
1030603416 7:111613950-111613972 CTGAGACTCTGAAGGTTAACAGG + Intergenic
1030915784 7:115311032-115311054 ATGTGATTCTGAAGATTATATGG + Intergenic
1031058279 7:117018730-117018752 GGGTTATTATGAAGATTAAATGG + Intronic
1032730158 7:134633509-134633531 CTGTTATTGTGAAGATAAAATGG - Intergenic
1033632194 7:143169732-143169754 CTGTTGTTGAGAAGGTAAAATGG + Intergenic
1033941760 7:146663408-146663430 CAGCTATTCTAAAGGTTATATGG - Intronic
1035615602 8:998937-998959 CTGTTATCCTGAAGGATACGTGG + Intergenic
1036523422 8:9513534-9513556 TTGTTATTCTAAAAGGTAAAAGG + Intergenic
1036834826 8:12053463-12053485 TTTTTATTCTGAAGCTTATAGGG - Intergenic
1036856669 8:12300027-12300049 TTTTTATTCTGAAGCTTATAGGG - Intergenic
1037268049 8:17089937-17089959 CTGTGATTCAGAAGGGAAAAGGG + Intronic
1039113767 8:34069211-34069233 CTGTTCTGATGAAGTTTAAATGG + Intergenic
1043029883 8:75120962-75120984 CTTTTATCCTTAAGGATAAAAGG + Intergenic
1043580946 8:81713529-81713551 CTGATATTGTGAAGTTTTAAAGG + Intronic
1043790249 8:84457133-84457155 TTGTCATTCTGAAGCATAAATGG + Intronic
1043861976 8:85329044-85329066 GTGTTGTTGTGAAGATTAAATGG + Intronic
1046377029 8:113397201-113397223 TTGTTAATCTGAATGGTAAAAGG + Intronic
1050007806 9:1152242-1152264 CTGTGATTCTGAAGGTTGTGAGG + Intergenic
1052581432 9:30359968-30359990 CTGTGACTCTGAACCTTAAAAGG - Intergenic
1053117152 9:35515034-35515056 CTGTTAATTTGAAAGATAAAGGG + Intronic
1055471399 9:76615132-76615154 TTGTTTTTCAGAAGGTCAAATGG + Intronic
1056404675 9:86262268-86262290 CTGTTTTACAGAAGGTTACATGG + Intergenic
1057254903 9:93538261-93538283 CTGTAATTCTCAAAGGTAAAAGG - Intronic
1057737619 9:97679191-97679213 CTGTAATACTTAAGGGTAAAGGG + Intronic
1058550417 9:106108808-106108830 TGGTTATTATGAAGGGTAAATGG + Intergenic
1059889159 9:118782013-118782035 GTGTTATTCTAAAGCATAAATGG - Intergenic
1060310469 9:122455312-122455334 CTGTTATTGGGAATGTAAAATGG - Intergenic
1203660270 Un_KI270753v1:35085-35107 CTCTGTTTCTGAAGTTTAAAGGG + Intergenic
1203671037 Un_KI270755v1:12048-12070 CTCTGTTTCTGAAGTTTAAAGGG + Intergenic
1186058280 X:5674763-5674785 CTGTTTTTCTTAATGATAAATGG + Intergenic
1189904208 X:45741343-45741365 CTGTAATTCTGGGGGTTATATGG + Intergenic
1191031422 X:55977690-55977712 ATTTTATTCTGAATGTTAAAGGG + Intergenic
1192039356 X:67601749-67601771 CTATTATTCTTATGGGTAAAAGG - Intronic
1193135566 X:77967683-77967705 CTCCCATTCTGTAGGTTAAAAGG + Intronic
1193188422 X:78540206-78540228 CTGTTATTGTGATGGTGAATGGG - Intergenic
1193658920 X:84233181-84233203 AAGTTGTTGTGAAGGTTAAAAGG - Intergenic
1194074098 X:89367427-89367449 CTTTTCTTTTCAAGGTTAAAAGG + Intergenic
1198034356 X:132786087-132786109 GGGTTGTTCTGAGGGTTAAATGG + Intronic
1199755658 X:150862558-150862580 CTTGCATTCTGGAGGTTAAAAGG - Intronic
1200729490 Y:6718954-6718976 CTTTTCTTTTCAAGGTTAAAAGG + Intergenic
1201054585 Y:9976005-9976027 CTGTGATTCAGAAGGAAAAAAGG + Intergenic