ID: 917638614

View in Genome Browser
Species Human (GRCh38)
Location 1:176960685-176960707
Sequence CTTCTTTTTTCACCAAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 244}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917638613_917638614 1 Left 917638613 1:176960661-176960683 CCTGATAGCTGATGGCTTCTTCT 0: 1
1: 0
2: 1
3: 13
4: 215
Right 917638614 1:176960685-176960707 CTTCTTTTTTCACCAAACCCTGG 0: 1
1: 0
2: 1
3: 27
4: 244
917638610_917638614 15 Left 917638610 1:176960647-176960669 CCAAAGAGGTCATCCCTGATAGC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 917638614 1:176960685-176960707 CTTCTTTTTTCACCAAACCCTGG 0: 1
1: 0
2: 1
3: 27
4: 244
917638612_917638614 2 Left 917638612 1:176960660-176960682 CCCTGATAGCTGATGGCTTCTTC 0: 1
1: 0
2: 1
3: 6
4: 164
Right 917638614 1:176960685-176960707 CTTCTTTTTTCACCAAACCCTGG 0: 1
1: 0
2: 1
3: 27
4: 244
917638607_917638614 23 Left 917638607 1:176960639-176960661 CCCAGCCTCCAAAGAGGTCATCC 0: 1
1: 0
2: 1
3: 8
4: 140
Right 917638614 1:176960685-176960707 CTTCTTTTTTCACCAAACCCTGG 0: 1
1: 0
2: 1
3: 27
4: 244
917638608_917638614 22 Left 917638608 1:176960640-176960662 CCAGCCTCCAAAGAGGTCATCCC 0: 1
1: 1
2: 4
3: 11
4: 164
Right 917638614 1:176960685-176960707 CTTCTTTTTTCACCAAACCCTGG 0: 1
1: 0
2: 1
3: 27
4: 244
917638609_917638614 18 Left 917638609 1:176960644-176960666 CCTCCAAAGAGGTCATCCCTGAT 0: 1
1: 0
2: 1
3: 17
4: 144
Right 917638614 1:176960685-176960707 CTTCTTTTTTCACCAAACCCTGG 0: 1
1: 0
2: 1
3: 27
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917638614 Original CRISPR CTTCTTTTTTCACCAAACCC TGG Intronic
901295972 1:8161170-8161192 CTTCCTTCTTCACCAGACCCAGG + Intergenic
901901728 1:12369810-12369832 TTTCATTCTTTACCAAACCCTGG + Intronic
903618135 1:24677328-24677350 CTTCATTTTACCTCAAACCCTGG - Intergenic
905833931 1:41100232-41100254 TCTCTTTTATCACCATACCCGGG - Intronic
908856392 1:68434356-68434378 CTCCTTTTTTAACCAAAATCTGG - Intronic
910266079 1:85339160-85339182 TTTCTTTTTTACCCACACCCTGG - Intronic
910541350 1:88361631-88361653 GTTCCCTTTTCACCAAATCCAGG + Intergenic
911073830 1:93854022-93854044 CTTCTTTTTTCACATAATCTTGG - Intergenic
911650489 1:100382588-100382610 CTTTTTTTTTCTCCAAGCTCAGG - Intronic
913674994 1:121132112-121132134 CTTCTTTTCTCCCTAACCCCTGG + Intergenic
914026834 1:143919744-143919766 CTTCTTTTCTCCCTAACCCCTGG + Intergenic
914665218 1:149827177-149827199 CTTCTTTTCTCCCTAACCCCTGG + Intergenic
914670547 1:149866644-149866666 CTTCTTTTCTCCCTAACCCCTGG - Intronic
916831631 1:168498154-168498176 TTACTTTCTTCACCAACCCCCGG - Intergenic
917638614 1:176960685-176960707 CTTCTTTTTTCACCAAACCCTGG + Intronic
918102916 1:181392008-181392030 CTTCCTCATTCACCAATCCCTGG - Intergenic
919696361 1:200580168-200580190 ATACTTTTTTCACCAAAAGCAGG + Intronic
919968503 1:202554109-202554131 AGTGTTTTTTCATCAAACCCCGG + Intronic
922120101 1:222657347-222657369 CTTCTTGTTTCTCTCAACCCAGG + Intronic
924447404 1:244146178-244146200 CTTCTTTTAACACCAAATACTGG + Intergenic
1064011815 10:11742150-11742172 TTTCTTTTTGCACCAACACCGGG - Intergenic
1065569166 10:27051076-27051098 CTTTTTCTTTCTCCAAAGCCTGG + Intronic
1065868601 10:29935720-29935742 CTTCATTATAAACCAAACCCTGG + Intergenic
1070569401 10:77629979-77630001 CTCCTTTTCTCACCATACCAGGG - Intronic
1070673773 10:78397878-78397900 CTGCTTGATTCACCAAACCCTGG + Intergenic
1071070470 10:81686164-81686186 TTTCTTTTTTCTACAAAGCCTGG - Intergenic
1072844757 10:98817388-98817410 GTTCTTTTTTCCCCAAAACTAGG + Intronic
1072910565 10:99497262-99497284 CTTCCTTTCCCTCCAAACCCAGG - Intergenic
1074411018 10:113228718-113228740 TTTCTCTTTTCACAAAACCCTGG - Intergenic
1074457079 10:113604547-113604569 TTTCTCCTTTCACCAAACCCGGG - Intronic
1074494259 10:113965184-113965206 CTTCTTATTTCACCAACTTCAGG - Intergenic
1075253657 10:120906615-120906637 CTCCTTTTTTCAACAAACTAGGG + Intronic
1078432178 11:11296544-11296566 CTTCTTCTGTCATCAAAGCCTGG + Intronic
1078839944 11:15069151-15069173 CTTCCTTTTTCAGGAAACCAAGG + Intronic
1079405607 11:20142707-20142729 CTGCTTATGTCATCAAACCCAGG + Intergenic
1080169620 11:29283968-29283990 CTTCTTTATACACCCAACACTGG - Intergenic
1080230335 11:30012742-30012764 CTTCTTTTCTCACCAAATTAAGG + Exonic
1080611903 11:33911598-33911620 CTTTTTTTTTAACAAAAGCCAGG - Intergenic
1080969082 11:37248174-37248196 TTTATTTTTATACCAAACCCTGG - Intergenic
1081663412 11:44902480-44902502 CTTCCTTCGTCACCAAGCCCAGG - Intronic
1082651527 11:55799845-55799867 CTTCCTTTTTCTCCATAACCTGG - Intergenic
1082926811 11:58557054-58557076 GTTCTTTTTTCTCCATACCCTGG - Intronic
1082998777 11:59273217-59273239 CCTCTTTTTTCAGTGAACCCAGG + Intergenic
1083742649 11:64719204-64719226 TTACTTTTCTCACCAAGCCCTGG - Intronic
1085399021 11:76224514-76224536 CTTGTTTTTTCACCAAATGCAGG - Intergenic
1087637701 11:100721268-100721290 GTGCTTTTCTCACCTAACCCAGG + Intronic
1087811543 11:102613730-102613752 CTTCTTTTGGCCCCAAACCTGGG - Intronic
1087960324 11:104340175-104340197 GTTCTTTTTTCACCTGACCAAGG - Intergenic
1088930147 11:114342963-114342985 CTTTTCTTTTCTCCAAAACCTGG - Intergenic
1092659354 12:10722504-10722526 CTCCTTTCTTCTCCAAACGCAGG + Intronic
1092957185 12:13561600-13561622 CTTCGTTCTTCCCCAAACCTTGG + Exonic
1093560896 12:20538555-20538577 CTTCCTTATTCACAGAACCCTGG - Intronic
1094262050 12:28511818-28511840 CTTCTGTTTCCACCATAACCGGG + Intronic
1095069812 12:37827257-37827279 TTTCCTTTTTCACCATAGCCAGG - Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097230081 12:57505500-57505522 TTTTTTTTTTCTCCAAGCCCAGG - Intronic
1101083130 12:101209243-101209265 CTCTTTTTTTCACTAAGCCCAGG + Intronic
1101376390 12:104174934-104174956 CTGCTGTGTTCACCAACCCCAGG - Intergenic
1101738402 12:107481167-107481189 CTTCTTTTTCCTCCAAAGCAGGG - Intronic
1102218381 12:111178088-111178110 CATCTTTTTTCCAGAAACCCTGG + Intronic
1102364363 12:112319155-112319177 CTTCTTCATTCACCCAACCCAGG + Intronic
1102804651 12:115769106-115769128 CTTCTTTGTTCCCTTAACCCTGG - Intergenic
1103178391 12:118885531-118885553 TTTCTTTTTTTACCATACTCAGG - Intergenic
1106174976 13:27322393-27322415 CCTCTTTTTCCTCCAAAGCCAGG - Intergenic
1106518286 13:30474033-30474055 CTCTCTTTTTCCCCAAACCCTGG - Intronic
1106899182 13:34336879-34336901 CTTCTTTTCTCTCCAGACACTGG - Intergenic
1107109328 13:36678913-36678935 CTTCTCTTTTCACACAAACCAGG - Intronic
1108095463 13:46896140-46896162 ATTATTTTCTCACCAAACCGAGG + Exonic
1109988926 13:70028130-70028152 TTTCTTATTTCTCCAAATCCAGG - Intronic
1111285144 13:86081257-86081279 CTGTTTCTTTCACCAAACCATGG - Intergenic
1112037699 13:95512830-95512852 CTTTTGTTTTCACCAATACCTGG + Intronic
1112341824 13:98558816-98558838 CTTCTTTTTGCATCAAACAATGG + Intronic
1112897012 13:104311536-104311558 CTTCTGTTTTCAGTAACCCCAGG + Intergenic
1112974239 13:105297669-105297691 CTTCTTTTTTCAACCACCCAGGG - Intergenic
1113312888 13:109149478-109149500 CATCTCCTTTCTCCAAACCCTGG + Intronic
1113552699 13:111205435-111205457 TTTCTTGTTTTACCAAAGCCAGG + Intronic
1115073863 14:29362065-29362087 TTTTTTTTTTCACCAAAGGCAGG - Intergenic
1118266927 14:64303238-64303260 CTTCTTTTTTCAAACAACCCAGG + Intronic
1121424598 14:93840601-93840623 TTTCTTTTTTCCCCCAAACCTGG + Intergenic
1123650023 15:22470210-22470232 CTTCTTTGTTAACAAAACCATGG + Intergenic
1123846523 15:24308920-24308942 CTTATTTTTATACCAAATCCTGG + Intergenic
1123865529 15:24515972-24515994 CTTATTTTTATACCAAATCCTGG + Intergenic
1124510750 15:30322377-30322399 CATCTTCTTCCACCATACCCAGG - Intergenic
1124732138 15:32208158-32208180 CATCTTCTTCCACCATACCCAGG + Intergenic
1124799007 15:32811252-32811274 CTTCTAATTTCACCACAACCAGG - Intronic
1126798439 15:52279393-52279415 CTTCTTTTTACAACAAACTCTGG + Intronic
1126881059 15:53098495-53098517 CTTATTTTTTCACTAAAATCTGG + Intergenic
1127131337 15:55867709-55867731 GTTCTTTGATCACCAAACCAGGG + Intronic
1127174819 15:56342460-56342482 CTTTTTTTTTGACCACACACAGG - Intronic
1127175327 15:56348756-56348778 CTTCTTATTTCACCATATCTGGG + Intronic
1127366448 15:58295028-58295050 CTTTTTTTTTCACCAGAGCATGG + Intronic
1127753775 15:62069861-62069883 TTTGTTTTTTCACCAAAAGCAGG - Exonic
1127926082 15:63544312-63544334 CTTCTTTTGTAACCAAATGCAGG + Intronic
1129824699 15:78627009-78627031 CTGCATTTTTAACCAATCCCTGG - Intronic
1135380112 16:21988898-21988920 ATTCTTTTTGAACCAAAACCAGG + Intronic
1135405097 16:22191559-22191581 CTCGGTTTTTCCCCAAACCCTGG - Exonic
1136459463 16:30400586-30400608 CTTCTTTTTTCTTTAATCCCTGG - Intergenic
1137868136 16:51922646-51922668 CTATTTTCTTCACCAAAGCCTGG + Intergenic
1138334806 16:56244692-56244714 CTATTTTTTCCACCACACCCAGG + Intronic
1139205079 16:65020982-65021004 TTTTTTTTTTTACCAAATCCTGG + Intronic
1139456498 16:67082964-67082986 TTTATTTTTTGACCAAACCGTGG - Intronic
1140543572 16:75783955-75783977 GTTCTCTTTTCTCCACACCCTGG + Intergenic
1140923952 16:79565232-79565254 CTTCTTTTTTCCACAAAAACAGG - Intergenic
1141138826 16:81484139-81484161 CATCTTTTTCCACCAACTCCAGG + Intronic
1142861924 17:2767466-2767488 CTTCTCTCTTCCCCCAACCCAGG + Intergenic
1142957096 17:3529630-3529652 ATTCTTTCTTCCCCAAAACCTGG - Intronic
1143698719 17:8640865-8640887 TATCTATTTTCAACAAACCCAGG - Intergenic
1146421771 17:32693500-32693522 CCTCTTTTTTCACCTAACATAGG + Intronic
1148898127 17:50852431-50852453 CTTCTTTATTCATCAAACCCAGG - Intergenic
1148907442 17:50920173-50920195 CTGCCTTTTTCACAACACCCAGG - Intergenic
1149130930 17:53301555-53301577 TTTCTTGTTTCTCCAGACCCTGG - Intergenic
1149594572 17:57856901-57856923 CTCTTTTCTTCACCAAACCTGGG + Intergenic
1150001359 17:61442846-61442868 CTTTTTTGTCTACCAAACCCAGG - Intergenic
1151781958 17:76252687-76252709 TTTTTTTTTTCACTATACCCGGG + Intergenic
1153587865 18:6642251-6642273 CATTTTATTTCACCAAACCCTGG + Intergenic
1157803999 18:50644538-50644560 CTTCCTTTCTCTCCAAGCCCTGG + Intronic
1159465049 18:68770812-68770834 CTTCTTTCTTCTACAAAGCCTGG - Intronic
1159555756 18:69942891-69942913 CTTCTCTCTTCCCCAGACCCCGG + Intronic
1159677761 18:71306991-71307013 CTTCTATTTGCACCAATCCTGGG - Intergenic
1160127926 18:76195484-76195506 CTTCTTTTTTCACTTGAACCTGG - Intergenic
1160158739 18:76454730-76454752 CTTCTTTTATCTTCAAAGCCTGG - Intronic
1164708168 19:30335648-30335670 CTTCTCTTCTCAGCCAACCCGGG + Intronic
1167245878 19:48373040-48373062 CTCCTTCTGCCACCAAACCCAGG - Intronic
1167525378 19:49980360-49980382 TTGCTTTTTTCACTTAACCCTGG - Intronic
1167654408 19:50754122-50754144 CCTCTTTGTGCACCAAATCCCGG - Intergenic
1167656099 19:50765268-50765290 CCTCTTTGTGCACCAAATCCCGG - Intergenic
927316444 2:21688778-21688800 TTTCCTTCTTCTCCAAACCCAGG - Intergenic
927628839 2:24752882-24752904 TTTTTTTTTTCTCCAAATCCTGG + Intronic
930367298 2:50456265-50456287 CTTCCTATCTCACCAAATCCTGG + Intronic
930457343 2:51622253-51622275 TTTCCTTTTTCCCCAGACCCAGG + Intergenic
932794341 2:74681608-74681630 CTTCTTGTTTCTCCAGTCCCTGG + Exonic
933016550 2:77135357-77135379 CTTCTGTTTTCATCATAACCAGG + Intronic
933896170 2:86811480-86811502 GTTCTTCTTTCACTAACCCCTGG + Intergenic
935168369 2:100589719-100589741 CTTGCTTTATCACCCAACCCTGG + Intergenic
935869107 2:107426068-107426090 CTTCTTGTTTCATCATACCATGG + Intergenic
936381430 2:111989926-111989948 TTTCATTTTTCACCAACACCAGG - Intronic
936937875 2:117855756-117855778 TTTCTTGTTTCTCCAAAGCCAGG + Intergenic
937749056 2:125452521-125452543 CTTTTTATTTCCCCAAAACCTGG - Intergenic
939349814 2:141021044-141021066 CTTCTTTTCTCTCAAAACCAAGG + Intronic
939986114 2:148831302-148831324 CTCATTTTTTGACCCAACCCAGG - Intergenic
940304916 2:152215263-152215285 CTTCATTTTCCACCAAATTCTGG + Intergenic
940584696 2:155631534-155631556 CTTTATTATTCACCAAACACAGG - Intergenic
940692541 2:156937371-156937393 CTTCCTTTTTCAATAAACACTGG - Intergenic
940906915 2:159178099-159178121 CTTCTTTATGCAGCAAACACTGG - Intronic
942642513 2:178074638-178074660 CTTCTTTTGTCCCCAGAGCCTGG - Intronic
942680887 2:178477530-178477552 CATTTTTTTACAACAAACCCAGG - Intronic
942866217 2:180678136-180678158 CTTCTTTTTCCTCCCACCCCTGG + Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
947474563 2:230431203-230431225 CTTCATTTCTAATCAAACCCAGG + Intronic
948337849 2:237224473-237224495 TTTCTGCTTTCACCAAACCCAGG + Intergenic
1169685959 20:8272095-8272117 CTTCTTTTTGCCCCAAAGACTGG - Intronic
1171640483 20:27343713-27343735 TTTCCTTTTTCACCATACGCCGG - Intergenic
1172153998 20:32810864-32810886 CTTCTTCCCTCCCCAAACCCTGG - Intergenic
1174121290 20:48267706-48267728 CTTTTCTTTTCTCAAAACCCTGG - Intergenic
1174414150 20:50356284-50356306 CTTCTGTTTTCTCCACAGCCTGG - Intergenic
1175682401 20:60999371-60999393 TTGCTTTGCTCACCAAACCCTGG - Intergenic
1175705612 20:61174439-61174461 CTTCCTGTTGCACCAAACACTGG + Intergenic
1176677488 21:9793064-9793086 GATCTTATTTCACCAAATCCAGG - Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1179278588 21:39914222-39914244 CTTCCTTCTTCACAAAACCCTGG + Intronic
1179328550 21:40375412-40375434 CTCCTTCTTCCACCATACCCAGG + Intronic
1181984493 22:26790051-26790073 CTGCCTTTCTCACCTAACCCAGG - Intergenic
1182496519 22:30712202-30712224 CCTCTTTCTTCTCCAAACCTTGG + Intronic
1184167326 22:42737611-42737633 CTTCATTTGTAACCAAACACAGG - Intergenic
1184687696 22:46103992-46104014 CTTCTTTTGCCCCCAGACCCGGG - Intronic
1184990888 22:48169299-48169321 CTTGTTTCTTCAGCAACCCCAGG - Intergenic
949472335 3:4409383-4409405 TTTTTCTTTTCACCAATCCCAGG - Intronic
949626581 3:5874117-5874139 CTTCATTTATCCCCAAACTCAGG - Intergenic
952181184 3:30918131-30918153 CTTGTAGTTTCCCCAAACCCTGG + Intergenic
952397756 3:32935972-32935994 CTTGTTATTACACCTAACCCAGG - Intergenic
952490923 3:33871826-33871848 CTTCTTTTTCCACTGAACCCTGG + Intergenic
953964596 3:47294046-47294068 CTTCATCTTTTACCTAACCCAGG + Intronic
953972459 3:47357606-47357628 CTGCACTTTTCACCAAAGCCAGG + Intergenic
953984255 3:47429209-47429231 CTTTTCTTTTCCCCAAATCCTGG + Intronic
955778662 3:62461067-62461089 ATTCTTCCTTCACTAAACCCTGG - Intronic
958944474 3:100348273-100348295 CTCATTTTTTCACCAAATACGGG + Intronic
959454628 3:106543499-106543521 CTAATTTTTACAGCAAACCCTGG - Intergenic
962308206 3:134307442-134307464 CTTTCTTCATCACCAAACCCAGG + Intergenic
963474419 3:145786672-145786694 CTTTTTTTTTCACCTACACCTGG - Intergenic
970703948 4:18777209-18777231 ATCATTTTTACACCAAACCCCGG + Intergenic
971617148 4:28806326-28806348 TTTATTTTTTCCCCAAAACCTGG - Intergenic
972071958 4:35032228-35032250 CTTCTGTTTTCACCAGTTCCAGG - Intergenic
972211962 4:36849242-36849264 CTTTTTTTTTCCCCAAAGCAAGG + Intergenic
972952618 4:44346934-44346956 CTTCATTTTCCACTGAACCCAGG - Intronic
974638803 4:64602285-64602307 CTTCTTTATACACCCAACCTGGG + Intergenic
974822068 4:67080123-67080145 TTTTTTTTTTCAACAAATCCAGG + Intergenic
976059848 4:81114310-81114332 TTTTTTTTTTCACCAAACACAGG - Intronic
977868601 4:102061696-102061718 CTAGTTGTTTCATCAAACCCTGG + Intronic
979980338 4:127247390-127247412 CTTTTCTTTTCTCCAAATCCTGG + Intergenic
980201747 4:129664418-129664440 ATTCTTATTTCAACAAAGCCAGG + Intergenic
980634365 4:135479919-135479941 CTTCTTTTTTCCACAAAACTTGG - Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982691393 4:158551299-158551321 CTCCATTTTTCCCCAGACCCTGG - Intronic
983534490 4:168842829-168842851 CTTTTTATTTCTCCAAAACCGGG - Intronic
983706999 4:170674037-170674059 CTTCTTTGCTAACCAAGCCCTGG + Intergenic
983901137 4:173135717-173135739 ATTCTTTATTCCCCAAACCAAGG - Intergenic
984512811 4:180699229-180699251 CTTCTTATTTCACCTAAAACGGG - Intergenic
985009450 4:185567694-185567716 TTTCTTTTTTCCCCAAACCAAGG + Intergenic
987548091 5:19339809-19339831 CTTCCTTTTTCTCCACAACCTGG + Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
988327579 5:29789638-29789660 CTTTTTTTGTCACCATACCAAGG + Intergenic
990259693 5:54008585-54008607 CTTATTTCTTCACCAAAGCCAGG + Intronic
990497353 5:56361924-56361946 GTTCTTTTTTCTCCACAACCTGG + Intergenic
990657515 5:57973411-57973433 ATTTTTTTTTCACCAAACAGTGG - Intergenic
990690910 5:58362912-58362934 CTGCTTACTTAACCAAACCCTGG - Intergenic
991950273 5:71940210-71940232 CTTCTCTTTTCCCCGAATCCAGG - Intergenic
992679842 5:79142779-79142801 TTTATTTTTTCCCCAAACTCTGG + Intronic
993137208 5:83984402-83984424 ATTCTTTTCTCAGCAAACACTGG + Intronic
993319830 5:86458606-86458628 GTTCAGTTTTCACCAAAGCCCGG - Intergenic
993481209 5:88426619-88426641 CTTTTTTTTTCATCAAATGCAGG + Intergenic
994585604 5:101705204-101705226 GTTCTTTTTTCCCAAAACCTTGG + Intergenic
994793988 5:104269571-104269593 TTTCTTGTTCCCCCAAACCCTGG - Intergenic
997810782 5:136966160-136966182 CTTCTGTTTTCCCCAACCCCTGG + Intergenic
1000268440 5:159659936-159659958 CTTCTTTCCCCACCAACCCCAGG - Intergenic
1000382488 5:160641600-160641622 GTTCTCCTTTCACCAACCCCTGG + Intronic
1001484978 5:172113184-172113206 ATTCTCTTTTCACCACATCCTGG - Intronic
1002059981 5:176620382-176620404 TTTTTTTTTTAACCAAAACCAGG - Exonic
1002705356 5:181157543-181157565 CTTCTATTTTCACCAGTCCTTGG - Intergenic
1002875288 6:1204514-1204536 CCTCATTTTTCACCATCCCCGGG - Intergenic
1004681738 6:17902404-17902426 CTTATTTTCTCTCCAAATCCTGG - Intronic
1005219037 6:23564923-23564945 CTTTTTTTTTCCCCAAACAAAGG - Intergenic
1005352184 6:24947585-24947607 CTTCTTTCTCCACCAGTCCCAGG - Intronic
1009715378 6:67386280-67386302 CTTCCTTTTTCTTCAAACCTTGG + Intergenic
1009830404 6:68923410-68923432 CTTCTTTTTTCATAAAACACTGG - Intronic
1011209059 6:84935312-84935334 CTTCTCTTTTCTCCACATCCTGG - Intergenic
1013376904 6:109526208-109526230 ATTATTTGTACACCAAACCCCGG + Intronic
1014977223 6:127902400-127902422 TTTCTTTAGTAACCAAACCCAGG + Intronic
1017985480 6:159439810-159439832 CTTCTTTTTCCCCTTAACCCAGG + Intergenic
1019774193 7:2902541-2902563 CTGGTTTTCTCACCCAACCCAGG - Intergenic
1020727099 7:11829856-11829878 TTTTTTTTTTTACCAAACCAAGG + Intronic
1022446029 7:30471529-30471551 ATTTTGTTTTTACCAAACCCTGG + Intronic
1023521096 7:41050651-41050673 CTTCCTATTTCCCCAAATCCAGG + Intergenic
1024913939 7:54477399-54477421 TTTCTTTTTTCTCCAAATCATGG + Intergenic
1026506667 7:70990381-70990403 GTTCTTTTCTCACAAAACCATGG + Intergenic
1027185096 7:75966346-75966368 TTTCTGTTTTCACCAAAGACTGG + Intronic
1027457749 7:78414750-78414772 GTCACTTTTTCACCAAACCCAGG - Intronic
1028287895 7:89026581-89026603 ATCCTTTTCTCACCACACCCAGG - Intronic
1028742254 7:94288956-94288978 CTTCTTTTTTCTCCTCCCCCAGG - Intergenic
1030260383 7:107558114-107558136 CTTATTTTTTCCCCAATCCAGGG - Exonic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1037607080 8:20447201-20447223 CTTCTTCTTTCCCCAAAGCAAGG - Intergenic
1038046669 8:23771544-23771566 CCTCTTATTTCACCAAAAACAGG - Intergenic
1038056642 8:23864751-23864773 CTTCTCTAGTCACCCAACCCAGG - Intergenic
1039333008 8:36559732-36559754 TCTCATTTTTCACCAAACTCCGG - Intergenic
1039514652 8:38122311-38122333 CTACTTCTTTCACCGAGCCCTGG + Intronic
1041336698 8:56793436-56793458 ATTCTTTCTTCACCTTACCCAGG - Intergenic
1042564109 8:70095706-70095728 TTTCTTTTTTTACCTAGCCCAGG - Intergenic
1043060062 8:75488853-75488875 CTGCTTTTCTGACCAAACCGAGG - Intronic
1044303519 8:90611749-90611771 CTCATTTTTACACCAAATCCTGG - Intergenic
1044435136 8:92153024-92153046 CTTCTTTCATCACCAATCCAGGG + Intergenic
1046710038 8:117500219-117500241 CTTCTTTTATAACCAAAGCTTGG + Intergenic
1048027914 8:130603774-130603796 ATTCCTTTTTCACCACATCCAGG + Intergenic
1049925875 9:406675-406697 ATTCATTTTTCAACAGACCCGGG + Intronic
1051876985 9:21803320-21803342 CTTCTTTTTCCTCCAAACGTAGG + Intronic
1052166558 9:25337562-25337584 CCTCTTTTTTCCCCAACCCCTGG - Intergenic
1060027814 9:120187708-120187730 TTTCTTTTCTCAAGAAACCCCGG - Intergenic
1061231327 9:129317632-129317654 GCTATGTTTTCACCAAACCCTGG + Intergenic
1061267179 9:129513648-129513670 TTTCTTTTTTCAATAAACCTTGG + Intergenic
1061593464 9:131613707-131613729 CTTCTCTCCTCACCAGACCCTGG - Intronic
1062215365 9:135386175-135386197 CCTCTCTTCCCACCAAACCCTGG - Intergenic
1186567281 X:10676878-10676900 CTTCCTATATCTCCAAACCCTGG + Intronic
1186814974 X:13227397-13227419 CTGCTTTTCTCATCCAACCCAGG + Intergenic
1188403569 X:29778573-29778595 CTTTTTCTTTCACCTAATCCTGG + Intronic
1188457424 X:30382416-30382438 GTTGGTTTTTCACCAATCCCTGG + Intergenic
1188572630 X:31606668-31606690 TTTATTTTTTCACCAAACCAAGG + Intronic
1188905926 X:35792075-35792097 CTTCCTATTTCACAAATCCCTGG + Intergenic
1190298215 X:49040838-49040860 ATTCTGTTTTCCTCAAACCCAGG - Intronic
1193489511 X:82132200-82132222 CTTCTGTTTCCACCACAACCAGG - Intergenic
1195001881 X:100650151-100650173 CTTCTCTGTTCTCCAAACCAGGG + Intronic
1198675326 X:139124836-139124858 CTGCTTTCTTCCCCAAATCCTGG - Intronic
1202304311 Y:23452083-23452105 GTGTTTTTTTCATCAAACCCCGG + Intergenic
1202566499 Y:26218508-26218530 GTGTTTTTTTCATCAAACCCCGG - Intergenic